Iranian Journal of Veterinary Medicine

Iranian Journal of Veterinary Medicine

Monitoring the prevalence of the tetracycline efflux genes among E. coli isolated from chicken colibacillosis

Document Type : Genetics - Immunology

Authors
1 Department of Microbiology, Faculty of Veterinary Medicine, Urmia University, Urmia, Iran.
2 Department of Pathobiology, Faculty of Veterinary Medicine, 5166, Tabriz University, 616471, Tabriz, Iran.
Abstract
BACKGROUND: Avian Colibacillosis can lead to important economic losses in the poultry industry. Escherichia coli the causative agent of this disease has acquired resistance to different antibiotics, including tetracycline. OBJECTIVES: This study was carried out to detect the distribution of tetracycline Group І efflux genes genes among E.coli isolates from from avian colibacillosis in Iran by PCR assay .METHODS: A total of 50 E. coli isolates from chicken colibacillosis were characterized by cultural, biochemical and PCR methods.
Kirby-Bauer disk diffusion method was used to define the resistance of isolates to tetracycline, then the Frequencies of tetracycline resistance genes (tetA, tetB, tetC, tetG, tetH, tetZ and tetE) were also determined using PCR method. RESULTS: According to biochemical and molecular experiments, 50 isolates from 237 chicken samples were recognized as E. coli. Seventy six(76%) of the isolates, however, were resistant to tetracycline. The distribution of tetracycline-resistance genes among E. coli isolates included tetB(34%) , tetA(26%), tetE(16%), tetC(15%), tetH(12%), tetG(12%) and tetZ(6%).
CONCLUSION: The present study highlights the prevalence of tetracycline resistant E. coli among chickens which is due to extensive
Keywords

Introduction

 

Widespread use of antibiotic agents is the most important factor causing emergence and dissemination of antimicrobial resistant bacteria (Van den Bogaard et al., 2001).

Antimicrobial drugs use in poultry production industries as a growth promotion factor, lead to the high resistance to antibiotic agents among avian infectious microorganisms (Romanus et al., 2012). Tetracycline is a broad - spectrum antibiotic that inhibits protein synthesis by binding to the bacterial ribosomes (Chopra and Roberts, 2001). There are four tetracycline resistance mechanisms in microorganisms including: efflux pumps, alteration in target receptors, ribosomal protection and enzymatic inactivation (Tuckman et al., 2007). Efflux pumps are transport proteins which could export antibiotics such as tetracycline from the cells to the outside (Webber and Piddock, 2003). Tetracycline efflux pumps belong to the six groups based on their amino acid sequences. Group 1 includes: TetA, TetB, TetC, TetE, TetD, TetG, TetH, TetZ, TetJ and TetI which are found exclusively in gram negative bacteria (Chopra and Roberts, 2001).

E. coli is an important microorganism among gram - negative bacteria (Sharma et al., 2013). Antibiotic resistance in E. coli strains isolated from human, animals and environment, has developed due to widespread use of antimicrobial agents for treatment of E. coli caused infections. (Wose Kinge et al., 2010). Among tetracycline resistance mechanisms, efflux proteins are the most important mechanism of resistance in E. coli (Tuckman et al. 2007).

Consequently, the increasing rate of antibiotic resistance among E. coli isolates complicates treatment of infections (Kibert and Abera, 2011).

Although in some studies the frequency of tetracycline resistance genes (tetA, tetB) in E. coli isolates recovered from commercial broiler chicken in east Azerbaijan were evaluated, there is not any complete study about the prevalence of other tetracycline efflux genes. So this work is the first study that evaluates the frequency of other efflux genes involved in tetracycline resistance in this area. The objective of the present study was to evaluate the occurrence of group І of tetracycline efflux genes in E. coli strains obtained from avian colibacillosis in east and west Azerbaijan in Iran.

 

Materials and Methods

 

Sample collection: During 2013-2015, a total number of 237 samples from chicken

carcasses suspected of colibacillosis were collected from 11 poultry farms located

in the provinces of east and west Azerbaijan. All chickens showed clinical signs including watery diarrhea, weakness, anorexia and weight loss before death. A thorough post-mortem examination of all dead birds was carried out. Liver and spleen samples were collected separately in sterile test tubes, then were used for bacteriological studies. 

Isolation of E. coli: All samples were cultured on Mac Conkey (Sigma Aldrich, USA) and EMB agar (Sigma Aldrich, USA) then incubated for 24h at 37 oC. E. coli colonies were examined by biochemical tests like growth on triple sugar iron agar (TSI) or citrate utilization, fermentation of indol, methyl red test, motility and urease test and the E. coli isolates were confirmed (Sharma et al. 2013). All isolated bacteria were frozen in trypticase soy broth with 30% glycerol (Sigma Aldrich, USA) at -70 oC (Tadesse et al., 2012).

Molecular confirmation of E. coli: DNA extraction. All E. coli isolates were cultured overnight in Nutrient broth media (Sigma Aldrich, USA) and their chromosomal DNA was extracted using bacterial genomic DNA purification kit (INTRON, Korea).

Primers and PCR. E. coli 16s rRNA gene was detected through PCR method using universal Primer Sequences used for PCR identification of E. coli 16s rRNA gene were 5´- GTA TAG ATA CCC TGG TAG TCCA-3´  as forward and 5´- CCC GGG AAC GTA TTC ACC G-3´ as reverse primers.

The PCR assay was done in a total volume of 25 µl by using INTRON premix. The PCR conditions using DNA thermo cycler (MWG AG BIOTECHTHERMAL CYCLER, USA) were as follow: Three min at 95 oC followed by 26 cycles of 94 oC for 1 min, 55 oC for 1min and 72 oC for 10 min (Sharma et al., 2013). The PCR products were analyzed by electrophoresis in 1% agarose gel.

Antimicrobial susceptibility testing: After identification of E. coli isolates by biochemical and molecular methods, the standard Kirby-Bauer disk diffusion method was used to determine the tetracycline resistance pattern among E. coli strains (Sayah et al., 2005).

Distribution of tetracycline resistance genes: All isolates which were resistant to tetracycline were examined further by the use of five PCR assays for the presence of tetA, tetB, tetE, tetC, tetH, tetZ and tetG genes. The primer sets used for amplification of these genes were shown in Table 2 (Aminov et al., 2002).

The first PCR assay used for amplification of tetE, consisted of initial denaturation at 94 oC for 1 min followed by 25 cycles at 94 oC for 1min, 1min of annealing at 50 oC and 72 oC for 10 min. The second PCR was performed for amplification of tetB as described above with the use of specific primers. The third assay was performed for amplification of tetA and tetC with annealing temperature of 48 oC.

The fourth assay was used to identify tetG as described above but the annealing temperature was 46 oC and finally the last amplification was carried out to identify tetH and tetZ genes using 46 oC as annealing temperature The PCR products were analyzed by agarose gel electrophoresis and the frequency of each tetracycline resistance determinants was determined.

 

Sequences

gene

Primer

GCGCGATCTGGTTCACTCG

tetA

Forward

AGTCGACAGYRGCGCCGGC

tetA

Reverse

TACGTGAATTTATTGCTTCGG

tetB

Forward

ATACAGCATCCAAAGCGCAC

tetB

Reverse

GCGGGATATCGTCCATTCCG

tetC

Forward

GCGTAGAGGATCCACAGGACG

tetC

Reverse

GGAATATCTCCCGGAAGCGG

tetD

Forward

CACATTGGACAGTGCCAGCAG

tetD

Reverse

GTTATTACGGGAGTTTGTTGG

tetE

Forward

AATACAACACCCACACTACGC

tetE

Reverse

GCAGAGCAGGTCGCTGG

tetG

Forward

CCYGCAAGAGAAGCAGAAG

tetG

Reverse

CAGTGAAAATTCACTGGCAAC

tetH

Forward

ATCCAAAGTGTGGTTGAGAAT

tetH

Reverse

CGAAAACAGACTCGCCAATC

tetJ

Forward

TCCATAATGAGGTGGGGC

tetJ

Reverse

CCTTCTCGACCAGGTCGG

tetZ

Forward

ACCCACAGCGTGTCCGTC

tetZ

Reverse

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Results

 

Out of 237 poultry carcasses samples suspected of colibacillosis, 21/09% (n=50) E. coli were isolated using culture and biochemical tests. Furthermore, molecular detection of E. coli isolates was carried out. 16s rRNA gene of E. coli was identified by PCR assay of extracted DNA using 16srRNA universal primers. Figure 1 shows the 16s rRNA   gene of E. coli strains found at 612bp on 100bp DNA ladder.

As the antimicrobial susceptibility test shows 76% of E. coli isolates were resistant to tetracycline. The percentage of isolates susceptible to tetracycline was 24%, none of the isolates showed intermediate susceptibility to the drug.

For detection of the tetracycline efflux genes frequency, among isolates, five PCR assays were used and results were shown in Fig. 2 to Fig. 6.

The most common determinants were tetB (34%) followed by tetA (26%). However, tetH (12%), tetG (12%), tetC (15%) and tetE (16%) were also found with different frequencies. The lowest Frequency among studied genes belonged to tetZ (6%).

 

Discussion

 

Among fifty E. coli isolates from chicken colibacillosis, 38 isolates were resistant to tetracycline. Study of the occurrence of tetracycline efflux genes showed that the tetB gene had the highest frequency among studied genes.

Antibiotics are usually used for treatment of bacterial infections in humans and animals. They are also used in commercial livestock and poultry food for promotion of growth. As a result, antimicrobial resistance among bacteria will be increased (Sayah et al., 2005).

Tetracyclines are broad spectrum antibacterials that have been used for a long period of time in humans and animals. But nowadays a widespread range of bacteria are showing resistance to tetracycline which encodes by several resistance genes (Trzcinski et al., 2000). Pathogenic strains of E. coli are common infectious microorganisms among gram negative bacteria, causing intestinal and extra intestinal infections. Many times, antibiotic therapy is needed for treatment of E. coli infections both in humans and veterinary medicine (Sharma et al., 2013). A great deal of evidence indicates that antimicrobial resistance in E. coli is the highest among other bacteria and tetracycline resistance is a very common resistance pattern in animal’s coliforms (Taddesse et al., 2012).

Advances in molecular bacteriology lead to detection and use of new techniques for describing the genetic determinants responsible for antibiotic resistance in bacteria. Also, designing of specific primers have provided accurate and rapid detection of antibiotic resistance genes (Blake et al., 2003). According to prior studies, tetracycline efflux pumps are important resistance mechanisms in E. coli and among these determinants tetB gene was the most prevalent, responsible for tetracycline resistance (Tuckman et al., 2007). Our results also confirm the prevalence of tetracycline resistance and the predominant role of tetB resistance gene among E. coli isolated from animals.

In 2004 distribution of tetracycline resistance genes in E. coli strains from diverse human and animal sources was examined by Brayan et al. The most common genes found in their isolates were tetB and tetA.  tetC and tetD were also found with lower frequencies. Also, Tuckman et al in 2007 monitored the prevalence of tetracycline resistance genes in E. coli strains by PCR assay. They revealed that tetB and tetA markers had the highest frequency among studied determinants. Our results are in accordance with their findings.

 Momtaz et al in 2012 evaluated the distribution of antibiotic-resistant genes in Escherichia coli isolates from slaughtered commercial chickens in Iran by PCR. The distribution of tetA and tetB genes in the E. coli isolates were 52.63%. Also, Wang et al in 2013 investigated the prevalence of antimicrobial-resistant chicken Escherichia coli strains and the resistance genes in E. coli. The detection rates of tetA, tetB genes were 95/3% and 97/4%. Here, we also used molecular PCR technique to determine the occurrence of tetracycline resistance genes in E. coli bacteria. Our results also indicate that tetB and tetA genes were the most frequent determinants for tetracycline resistance.  Relative to the results obtained in the detection of antimicrobial resistance genes, in a study of E. coli isolated strains from broiler chickens in Brazil, Santos et al. (2014) observed the concomitant presence of tetA and tetB and genes. This is consistent with the detection of two resistance genes in the strains of E. coli in the present study.

The high percentage of phenotypes of E. coli isolates that were resistant to tetracycline, suggested that the widespread use of tetracycline in poultry creates the reservoir of resistant bacteria and resistance genes and may shorten the time that this antimicrobial agent will be available for effective treatment of infections in poultry.

Examining the frequency of tetracycline resistance genes among E. coli isolated from chicken colibacillosis, confirmed the presence of tetracycline resistance genes in most of the E. coli isolates and pictured the distribution pattern of these determinants which is very similar to the prior findings about these determinants.

 

Acknowledgments

 

This work was supported by Tabriz University, Tabriz, Iran.

Aminov, R.I., Chee-Sanford, J.C., Garrigues, N., Teferedegne, B., Krapac, I.J., White, B.A.,       Mackie, R.I. (2002) Development, validation and application of PCR primers for detection of Tetracycline Efflux genes of gram negative bacteria. Appl Environ Microbiol. 68: 1786-1793. DOI: 10.1128/aem.68.4.1786-1793.##
Blake, D.P., Humphry, R.W., Scott, K.P., Hillman, K., Fenlon, D.R., Low, J.C. (2003)             Influence of tetracycline exposure on tetracycline resistance and carriage of tetracycline resistance genes within commensal Escherichia coli populations. J Appl Microbiol. 94: 1087-1097. DOI: 10.1046/j.1365-2672.2003.01937.x.##
Bryan, A., Shapir, N., Sadowsky, M.J. (2004) Frequency and distribution of tetracycline resistance genes in genetically diverse, none selected and nonclinical Escherichia coli strains isolated from diverse human and animal sources. Appl Environ Microbiol. 70: 2503-7. DOI:10.1128/aem.70.4.2503-2507.##
Chopra, I., Roberts, M. (2001) Tetracycline antibiotics: mode of action, applications, molecular biology and epidemiology of bacterial resistance. Microbiol Mol Biol. 65: 232-60. DOI: 10.1128/mmbr.65.2.232-260.##
Kibert, M., Abera, B. (2011) Antimicrobial susceptibility patterns of  E. coli from clinical sources  in northeast Ethiopia. Afr Health Sci. 11: 40-44. DOI:10.4314/ahs.v11i3.70069.##
Momtaz, H., Rahimi, E., Moshkelani, S. (2012) Molecular detection of antimicrobial resistance genes in E. coli isolated from slaughtered commercial chickens in Iran. Vet Med. 57, 2 (4): 193-197. https://www.researchgate.net/publication/237047427.##
Romanus, I., Chinyere, O.E., Amobi, N.E., Anthonia, O.E., Ngozi, A.F., Chidiebube, N.A., Eze, A.T. (2012) Antimicrobial resistance of Escherichia coli isolated from animal and human clinical sample. Global Res J Microbiol. 2: 85-89.##
Santos, M.M., Alcantara, A.C.M., Perecmanis, S.I., Campos, A., Santana, A.P. (2014) Antimicrobial resistance of bacterial strains isolated from avian cellulitis. Braz J Poult Sci. 16: 13-18.DOI: 10.1590/s1516-635x2014000100002.##
Sayah, R.S., Kaneene, J.B., Johnson, Y., Miller, R. (2005) Patterns of antimicrobial resistance observed in Escherichia coli isolates obtained from domestic and wild animal fecal samples, human septage, and surface water. Appl Environ Microbiol. 71: 1394- 1404.DOI: 10.1128/aem.71.3.1394-1404.##
Sharma, S., Mahajan, B., Patidar, R.K., Sahare, K.N., Khare, M. (2013) Molecular detection of antimicrobial resistance genes in biofilm forming Escherichia Coli. Am J Pharm Health Res. 1: 2321-3647. ##
Tadesse, D.A., Zhoa, SH., Tong, E. Ayers, SH., Singh, A., Bartholomew, M.J., Mc Dermott, P.F. (2012) Antimicrobial drug resistance in Escherichia coli from humans and food animals, United States 1950-2002, Emerg Infect Dis. 18: 741-749. DOI:10.3201/eid1805.111153.##
Trzysztof, K., Cooper, B.S., Hryniewicz, W., Dowson, C.G. (2000) Expression of resistance to tetracyclines in strains of methicillin-resistant Staphylococcus. J Antimicrob Chemother 2000; 45(6): 763-770. DOI: 10.1093/jac/45.6.763.##
Tuckman,  M., Petersen, P.J., Howe, A.Y.M., Orlowski, M., Mullen, S, Chan, K., Bradford, P.A. (2007) Hal Jones CH. Occurrence of tetracycline resistance genes among Escherichia coli isolated from the phase 3 clinical trials for  tetracycline. Antimicrob Agents Chemother. 51: 3205-11. DOI:  10.1128/aac.00625-07.##
Van den Bogaard, A.E., London, N., Driessen, C., Stobberingh, E.E. (2001) Antibiotic resistance of fecal Escherichia Coli in poultry, Poultry farmers and Poultry slaughteres. J Antimicrob Chemother. 47: 763-771.##
Wang, J.Y., Tang, P., Cui, E.H., Wang, L.Q., Liu, W.H., Ren, J.J., Wu, N., Qiu, W.H.,  Liu, .HJ. (2013) Characterization of antimicrobial resistance and related resistance genes in Escherichia coli strains isolated from chickens in China during 2007-2012. Afr J Microbiol Res. 7: 5238-5247. DOI: 10.5897/AJMR2013.5860.##
Webber, M.A., Piddock, L.J.V. (2003) The importance of efflux pumps in bacterial antibiotic resistance. J Antimicrob Chemother. 51: 9-11. DOI:10.1093/jac/dkg050. ##
Wose King, C.N., Njie Ateba, C., Tonderai Kawadza, D. (2010) Antibiotic resistance profiles of Escherichia coli isolated from different water sources in the mmabatho locality, north- West province. South Afr J Sci; 106 (1/2): 44- 49. DOI: 10.4102/sajs.v106i1/2.14.##