Iranian Journal of Veterinary Medicine

Iranian Journal of Veterinary Medicine

A survey on detection of coronavirus in neonatal calf diarrhea in dairy farms of Iran

Document Type : Infectious agents- Diseases

Authors
1 Department of Internal Medicine, Faculty of Veterinary Medicine, University of Tehran,Tehran, Iran.
2 Department of Internal Medicine, Faculty of Veterinary Medicine, University of Tehran,Tehran – Iran.
3 Department of microbiology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran.
Abstract
BACKGROUND: Bovine coronavirus (BCoV) is a primary cause of neonatal calf diarrhea worldwide, and is also associated with acute diarrhea in adult cattle during the winter season, resulting heavy economic losses to both dairy and beef industry throughout the world. OBJECTIVE: The Objective of the present study was to screen the fecal samples for BCoV collected from diarrhea from six geographic region of Iran, with the aim to deepen the knowledge of BCoV prevalence and epidemiology in Iran. MEETHODS: 194 fecal samples from diarrheic calves up to one-month age, based on the geographic area were collected. Samples from all the cases were screened for the presence of BCoV by commercially available ELISA kit. Furthermore, all positive samples were subjected to RT-PCR for confirmation. RESULTS: ELISA examination revealed that 7.2 % of taken samples, were positive. All positive samples in ELISA were also positive in RT-PCR. All samples from northwest, northeast, and west, were negative. The average ages of positive calves were nine days. The average stool scores in positive samples and negative samples were 2.5 and 2.1 respectively. 71/4 % of positive samples had fever. CONCLUSION: The results of the present study showed that the occurrence of BCoV in stool samples of diarrheic calves in dairy farms of Iran is lower than the other reports on the world.
Keywords

Introduction

Bovine coronavirus (BCoV) is an important livestock pathogen with a high prevalence worldwide. The virus causes diarrhea and respiratory disease in neonatal calves and winter dysentery in adult cattle. These diseases result in substantial economic losses and reduced animal welfare (Boileau and Kapil, 2010; Oma et al., 2016).  It has been found that in beef calves, BCoV infection was more frequent among calves up to 30 days of age (Quinn et al., 2002; Afshari et al., 2012).

Serological surveys indicate that approximately 90% of the worldwide cattle population has antibodies (Abs) against BCoV (Boka et al., 2015). A number of researchers showed wild ruminants, dogs, and horses harbor similar strains of BCoV which is transmissible to cattle and vice versa (Barros et al., 2013; Saif et al., 2010).

Inter-herd transmission is possible either directly via import of live animals (Decaro et al., 2008, Fulton et al., 2011), or indirectly via contaminated personnel or equipment (Mee et al., 2012). Measures to prevent the virus spread between herds must be based upon knowledge of viral shedding, the potential for transmission to susceptible animals and the role of protective immunity (Oma et al., 2016). In two experimental studies, infected calves were not protected against reinfection with a different BCoV strain three weeks after the first challenge, but did not develop clinical signs (Cho KO et al., 2011; El-Kanawati et al., 1996). BCoV is transmitted via the fecal-oral or respiratory route.  The virus infects epithelial cells of the respiratory tract (the nasal turbinates, trachea and lungs) and the intestines (the villi and crypts of the small and large intestine) (Park et al., 2007, Saif et al., 1986).

Three antigenic groups of coronaviruses have been established, and all BCoV strains belonged to the subgroup initially designated as 2a (Hasoksuz et al., 2008). The International Committee for Taxonomy Viruses (ICTV) has proposed a revision of the family Coronaviridae to create a new subfamily, Coronavirinae, that includes the Alpha, Beta and Gammacoronavirus genera. Following this new suggested taxonomy, BCoV belongs to the Betacoronavirus genus, cluster within the Coronavirinae subfamily, Coronaviridae family and the order Nidovirales (http://ictvonline.org/virusTaxonomy.asp).

The virus genome is comprised of single stranded nonsegmented positive-sense RNA (32 kb) associated to the nucleoprotein (N) and forming a nucleocapsid with helical symmetry (Clark, 1993). Viral particles are large (100-150 nm), pleomorphic and enveloped with four major structural proteins comprising a membrane (M) glycoprotein, an envelope (E) protein, a spike (S) glycoprotein and the hemagglutinin-esterase (HE) glycoprotein (Lai, 2001). It is interesting to note that the hemagglutinating activity of the HE from BCoVs strains is lower than the hemagglutinating activity of the S glycoprotein, which forms large spike-like projections in the viral envelope (Schultze et al., 1991).

Moreover, the S glycoprotein harbors domains responsible for receptor binding and induction of neutralizing antibodies, and is the most polymorphic viral protein among CoV species and also among strains of the same species. It is utilized for the molecular characterization of the isolates (Collins et al., 1982). The S glycoprotein consists of two subunits, S1 (N-terminal half) and S2 (C-terminal half). The S1 hypervariable region is useful to study the variability and evolution of this virus (Brandao et al., 2006; Hasoksuz et al., 2002).

BCoV has worldwide distribution and is  reported from several countries (Jeong et al 2005; Khalili et al., 2006; Takiuchi et al 2006; Traven et al 2006; Gumusova et al 2007; Park et al 2007, Boileau and Kapil, 2010; Dash et al 2012; Ohlson et al., 2013; Mawatari et al., 2014; Ammar et al., 2014). However epidemiological data on BCOV in Iran is scarce.

Therefore, the aim of the present study was to screen the fecal samples for BCoV collected from clinical cases with the history of diarrhea from six geographic region of Iran covering 27 dairy farms.

 

Materials and Methods

 

Sample collection: Selected geographical regions for sampling, which were chosen based on density of dairy farms and climates, were northwest, northeast, southwest, south of Alborz Mountains, west, and central regions of Iran, (Table 1).

Totally 194 samples were collected from diarrheic neonatal calves up to one-month of age from May 2014 to June 2016. Samples were collected directly from the calves’ rectum into sterile bottles and transferred to Virology laboratory of the Veterinary Faculty of University of Tehran on ice pack and stored at -18 °C.  Sample’s specifications such as:  name of farm, province, geographic region, age, gender, stool consistency score, and rectal temperature were recorded.

BCoV antigen ELISA. An indirect antigen-capture ELISA kit employing monoclonal antibodies to BCoV was used as described by the manufacturer (IDEXX Rota-Corona-k99, USA).

Then the positive samples in ELISA were conducted on  RT-PCR for confirmation.

Preparation of oligonucleotide primers. The oligonucleotide primers used in the RT-PCR were designed from the published sequence of N gene of Mebus strain (GenBank accession No.U00735). The sequences of primers are shown in Table 2, and the predicted RT-PCR product size was 407 bp (Table 2).

RNA extraction and RT-PCR. RNA from faeces was extracted using RNX-Plus solution for total RNA isolation (Sinaclon Bioscience, Iran) as instructed by the manufacturer. Then the complementary DNA (CDNA) was conducted by Maxime RT premix kit (Intron Biotechnology, Korea) as instructed by the manufacturer. The RT-PCR was conducted using the following procedure: in a  tube 3 μL of CDNA sample was added to 2 μL of the Reverse and forward primers and 5.5 μL of nuclease-free water, and finally 12.5 μL master mix was added to the solution. Then the solution waspreheated for 5 min  at 94 °C, 40 cycles, including 45 seconds at 94 °C, 45 seconds at 52 °C, 1 min at 72 °C and, finally, 10 min incubation at 72 °C was applied. The PCR products were visualized on 1.5% agarose gel stained with ethidium bromide. PCR products of 407 bp were detected.

 

Region

Province

Sample   numbers

Farms   numb

northwest

Zanjan

10

1

northeast

Mashhad

30

4

northeast

Gorgan

10

2

south of   Alborz

Tehran

40

6

south of   Alborz

Varamin

10

1

south of   Alborz

Qazvin-Alborz

20

5

Central

Qom

10

2

Central

Isfahan

30

1

Central

Saveh

12

1

west

Kermanshah

10

1

southwest

Ahvaz

12

3

Total

11

194

27

 

Table (1): Selected geographical regions for sampling, dairy farms and climates.

 

 

 

virus

target   gene

primer

sequence   (5 ′-3 ′)

position

product   length

refrence   no.

BCV

Nucleocapsid

BCV-N-f

GCCGATCAGTCCGACCAATC

29475-29494

407

Tsunemitsu   et al, 1999

 

 

 

BCV-N-R

AGAATGTCAGCCGGGGTAT

 

 

Masaharu   et al, 2012

 

Table (2): The sequences of primers and the predicted RT-PCR product size.

 

 

 

Results

 

ELISA examination of stool samples revealed that 14 samples (7.2%) out of 194 taken samples, which  belonged to 10 dairy farms (37.03%) out of 27 farms were positive (7.2%).  The positive samples were found in Tehran (three samples), Qom (two samples), Isfahan (three samples), Qazvin (two samples), Alborz (two samples), Saveh (one sample) and Ahvaz. The Zanjan, Mashhad, Gorgan, Varamin, and Kermanshah samples were negative. On the other hand, all samples from northwest, northeast, and west, were negative while samples from three other geographic regions were positive. All positive samples in ELISA were positive in RT-PCR.

The average age of positive calves was nine days, and 38% were male and 62 % were female.

The average stool score in the positive samples and negative samples was 2.5 and 2.1 respectively (based on 0-3 scoring).  Fecal consistency data were recorded on a scale of 0-3, with score increasing severity (0 = normal feces, 3 = severe diarrhea) (Operario et al, 2015). Degree of fecal consistency: 0 = normal, manure is normal and well formed; 1 = abnormal feces but not diarrhea, manure is pasty (softer than normal); 2 = mild diarrhea (feces are semi liquid, but still have a solid component); and 3 = liquid feces only (Mathur et al, 2001).

10 samples from the positive samples (71/4 %) had fever (rectal temperature≥40 °C).

 

Discussion

 

In the present study, Coronavirus was detected in 7.3% of diarrheic calves. Almost the same results about occurrence of BCoV were found in some other studies in Sweden (De Verdier, 2006), Japan (Kirisawa et al., 2007), Switzerland (Uhde et al 2008) and Holland (Bartels, 2010). In contrast, BCoV appeared to be of more importance with higher prevalence in some other studies in countries such as Spain (De la Fuente et al 1998; Perez et al 1998), France (Bendali et al., 1999), Brazil (Stipp et al., 2009), India (Hansa et al., 2012), Australia (Izzo et al., 2011), Korea (park et al., 2007) and Turkey (Hasoksuz et al., 2005). A few studies also had lower prevalence, including studies in Pakistan (Alikhan, 2009, 2 %) and Argentina (Bok et al., 2015, 5 %).

In one regional study in Iran, 12.03% of diarrhetic samples were positive with both capture ELISA and RT-PCR (Khalili et al., 2006). Mayameei et al., 2010 in Tehran dairy farms showed that the prevalence of Coronavirus infection in diarrheic calves is 3.17%.  In another study in Mashhad province, Coronavirus antigen was detected in 2.7% and 1.8% of diarrheic and non-diarrheic calves, respectively (Afshari et al., 2012). In the present study 28.57 % and 71.43 % of positive samples were in the age group 0-7 days and >7 days respectively. In another study, calves were divided to different age groups 1-15, 16-30, 31-45, and 46-60 days. Age group 16-30 days had most positive samples (29 %), but at least one or more positive samples were seen in other groups (Stipp et al., 2009).

In the present study, there was not any significant association between the presence of Coronavirus in feces and stool score and fever (rectal temperature >40) of calves (p> 0.05).  More than 85% of positive samples had a stool score ≥2 with an average of 2.5. Also, about 71% of positive samples had a rectal temperature >40. In some studies (Busato et al 1998; Bjorkman et al 2003; Erdogan et al 2003) no  significant association was found between the presence of Coronavirus in feces and clinical diarrhea but in some other studies, there was a significant association between shedding of Coronavirus in feces and diarrhea (Reynolds et al 1986, Perez et al 1998, Bendali et al 1999a, Stipp et al., 2009).

 The results of the present study showed that the occurrence of coronavirus in stool samples of diarrheic calves in dairy farms of Iran is lower than the other reports in the world. The occurrence and also diagnosis of enteropathogens in the feces of diarrheic and non-diarrheic calves varies depending on the geographic location, the farm, the age and type of calves being examined and the extent to which the diagnostic laboratory is capable of isolating or demonstrating the causative pathogens. On the other hand, the role of other infectious agents in diarrhea in different countries and regions and the sensitivity and specificity of used tests in each study can explain the observed differences in prevalence of Coronavirus among a variety of studies. In addition, some of the possible reasons for low prevalence of Coronavirus in the present study are that most samples were not collected during winter, the season in which the prevalence of calf diarrhea caused by Coronavirus is higher than other seasons.Also, the sensitivity of ELISA test, used as screening test in this study, is lower than PCR, moreover, Iran has a hot, dry climate, opposed to the Coronavirus desirable stability condition.

 

Acknowledgments

 

The authors thank the staff of the microbiology department of Faculty of Veterinary Medicine, University of Tehran for providing equipment and lab. We are also grateful to all people helping us for sample collection

 
Afshari Safavi, E.A., Mohammadi, G.R., Rad, M., Naghibi, A. (2012) A case-control study of association between diarrhea in newborn calves and infection with rotavirus and coronavirus in some industrial dairy herds of Mashhad aarea, Iran in 2008. Arch Razi Inst. 67: 35-41.##
Ammar, S.S., Mokhtaria, K., Tahar, B.B., Amar, A.A., Redha, B.A., Yuva, B., Mohamed, H.S., Abdellatif, N., Laid, B. (2014) Prevalence of rotavirus (GARV) and coronavirus (BCoV) associated with neonatal diarrhea in calves in western Algeria. Asian Pac J Trop Biomed. 4: 318-322.##
Bartels, C.J., Holzhauer, M., Jorritsma, R., Swart, W.A., Lam, T.J. (2010) Prevalence, prediction and risk factors of enteropathogenes in normal and non-normal faeces of yang Dutch dairy calves. Prev Vet Med. 93: 162-169.##
Bendali, F., Bichet, H., Schelcher, F., Sanaa, M. (1999) Pattern of diarrhea in newborn beef calves in southwest France. Res Vet Sci. 30: 61-74.##
Bjorkman, C., Svensson, C. Christensson, B., De Verdier, K. (2003) Cryptosporidium parvum and Giardia intestinalis in calf diarrhoea in Sweden. Acta Vet Scand. 44: 145-152.##
Boileau, M.J., Kapil, S. (2010) Bovine coronavirus associated syndromes. Vet Clin North Am Food Anim Pract. 26: 123-146.##
Boka, M., Miñoa S., Rodrigueza, D., Badaraccoa, A., Nuñesc, I., Souzac, S.P., Bilbao, G., Louge Uriarte, E., Galarza, R., Vega, C., Odeon, A., Saif, L.J., Parreño, V.  (2015) Molecular and antigenic characterization of bovine Coronavirus circulating in Argentinean cattle during 1994-2010. Vet Microbiol. 181: 221-229.##
Brandao, P.E., Gregori, F., Richtzenhain, L.J., Rosales, C.A., Villarreal, L.Y., Jerez, J.A., (2006) Molecular analysis of Brazilian strains of bovine coronavirus (BCoV) reveals a deletion within the hypervariable region of the S1 subunit of the spike glycoprotein also found in human coronavirus OC43. Arch Virol. 151: 1735-1748.##
Busato, A., Lentze, T., Hofer, D., Burnens, A., Hentrich, B., Gaillard, C. (1998) A case control study of potential enteric pathogens for calves raised in cow-calf herds. J Vet Med B. 45: 519-528.##
Cho, KO., Hasoksuz, M., Nielsen, PR., Chang, KO., Lathrop, S., Saif, LJ. (2001) Crossprotection studies between respiratory and calf diarrhea and winter dysentery coronavirus strains in calves and RT-PCR and nested PCR for their detection. Arch Virol. 146: 2401-2419.##
Clark, M.A. (1993) Bovine coronavirus. Br Vet J. 149: 51-70.##
Dash, S.K., Kumar, K., Goel, A., Bhatia, A.K. (2012) Detection of coronavirus antigen by ELISA from diarrhoetic cow calves in Mathura, India. Vet World. 5: 166-168.##
De la Fuente, R., Garcia, A., Ruiz-Santa-Quiteria, J.A., Luzon, M., Cid, D. Garcia, S., Orden, J.A., Gomez-Bautista, M. (1998) Proportional morbidity rates of enteropathogens among diarrheic dairy calves in central Spain. Prev Vet Med. 36: 145-152.##
de Verdier, K. (2006) Infektionspanoramat vid diarréer hos svenska kalvar. Svensk Veterinärtidning. 8-9: 29-32.##
Decaro, N., Mari, V., Desario, C., Campolo, M., Elia, G., Martella, V., Greco, G., Cirone, F., Colaianni, M.L., Cordioli, P., Buonavoglia, C. (2008) Severe outbreak of bovine coronavirus infection in dairy cattle during the warmer season. Vet Microbiol. 126: 30-9.##
El-Kanawati, Z.R., Tsunemitsu, H., Smith, D.R., Saif, L.J. (1996) Infection and cross-protection studies of winter dysentery and calf diarrhea bovine coronavirus strains in colostrum-deprived and gnotobiotic calves. Am J Vet Res. 57: 48-53.##
Erdogan, H.M., Unver, A., Gunes, V., Citil, M. (2003) Frequency of rotavirus and coronavirus in neonatal calves in Kars district. KAFKAS ÜNİVERSİTESİ, Veteriner Fakültesi Derg. 9: 65-68.##
Fulton, R.W., Step, D.L., Wahrmund, J., Burge, L.J., Payton, M.E., Cook, B.J., Burken, D., Richards, C.J., Confer, A.W. (2011) Bovine coronavirus (BCV) infections in transported commingled beef cattle and sole-source ranch calves. Can J Vet Res. 75: 191-199.##
Gumusova, S.O., Yazici, Z., Albayrak, H., Meral, Y. (2007) Rotavirus and coronavirus prevalence in healthy calves and calves with diarrhea. Medycyna Weterynaryjna. 63: 62-64.##
Hansa, A., Rai, R.B., Yaqoob Wani, M., Dhama, K.  (2012) ELISA and RT-PPCR based detection of Bovine Coronavirus in north India. Asian J Anim Vet Adv. 7: 1120-1129.##
Hasoksuz, M., Sreevatsan, S., Cho, K.O., Hoet, A.E., Saif, L.J. (2002) Molecular analysis of the S1 subunit of the spike glycoprotein of respiratory and enteric bovine coronavirus isolates. Virus Res. 84: 101-109.##
Hasoksuz, M., Vlasova, A., Saif, L.J. (2008) Detection of group 2a coronaviruses with emphasis on bovine and wild ruminant strains. Virus isolation and detection of antibody antigen, and nucleic acid. Methods Mol Biol. 454: 43-59.##
Izzo, M.M., Kirkland, P.D., Mohler, V.L., Perkins, N.R., Gunn, A.A., House, J.K. (2011) Prevalence of major enteric pathogens in Australian dairy calves with diarrhea. Aust Vet J. 89: 167-73.##
Jeong, J.H., Kim, G.Y., Yoon, S.S., Park, S.J., Kim, Y.J., Sung, C.M., Jang, O.J., Shin, S.S., Koh, H.B., Lee, B.J., Lee, C.Y., Kang, M.I., Kim, H.J., Park, N.Y., Cho, K.O. (2005) Detection and isolation of winter dysentery bovine coronavirus circulated in korea during 2002-2004. Vet Med Sci. 67: 187-189.##
Khalili, M., Morshedi, A., Keyvanfar, H., Hemmatzadeh, F. (2006) Detection of bovine coronavirus by RT-PCR in a field study.  Vet Ski Arh. 76: 291-29.##
Kirisawa, R., Takeyama, A., Koiwa, M., Iwai, H. (2007) Detection of bovine torovirus in fecal specimens of calves with diarrhea in Japan. J Vet Med Sci. 69: 471-476.##
Lai, M.H.K.V. (2001) Coronaviridae: the viruses and their replication. In: Fields Virology. Fields, B.N., Howley, P.M., DMK (eds.). Lippincott - Raven, Philadelphia, USA. p. 1163-1186.##
Masaharu, F., Kazufumi K., Ayako M., Tohru S., Keito T., Tsunehiko A., Masaji, M., Makoto, S., Hiroshi, T. (2012) Development and application of one-step multiplex reverse transcription PCR for simultaneous detection of five diarrheal viruses in adult cattle. Arch Virol. 157: 1063-1069.##
Mathur, S., Constable, P.D., Eppley, R.M., Waggoner, A.L., Tumbleson, M.E., Haschek, W.M. (2001) Fumonisin B1 is hepatotoxic and nephrotoxic in milk-fed calves, Toxicol Sci. 60: 385-396.##
Mawatari, T., Hirano, K., Ikeda, H., Tsunemitsu, H., Suzuki, T. (2014) Surveillance of diarrhea-causing pathogens in dairy and beef cows in Yamagata prefecture, Japan from 2002 to 2011. Microbiol Immunol. 58: 530-535.##
Mayameei, A., Mohammadi, Gh., Yavari, S., Afshari, E., Omidi, A. (2010)  Evaluation of relationship between Rotavirus and Coronavirus infections with calf diarrhea by capture ELISA. Comp Clin Pathol. 19: 553-557. ##
Mee, J.F., Geraghty, T., O’Neill, R., More, S.J. (2012) Bioexclusion of diseases from dairy and beef farms: risks of introducing infectious agents and risk reduction strategies. Vet J. 194: 143-50.##
Ohlson, A., Alenius, S., Traven, M., Emanuelson, U. (2013) A longitudinal study of the dynamics of bovine corona virus and respiratory syncytial virus infections in dairy herds. Vet J. 197: 395-400.##
Operario, D.J., Bristol, L.S., Liotta, J., Nydam, D.V., Houpt, E.R. (2015) Correlation between diarrhea severity and oocyst count via quantitative PCR or fluorescence microscopy in experimental cryptosporidiosis in calves.  Am J Trop Med Hyg. 92 45-49.##
Park S.J., Kim G.Y., Choy H.E., Hong Y.J., Saif L.J., Jeong J.H., Park, S.I., Kim, H.H., Kim, S.K., Shin, S.S., Kang, M.I., Cho, K.O. (2007) Dual enteric and respiratory tropisms of winter dysentery bovine coronavirus in calves. Arch Virol. 152: 1885-900.##
Park, S.J., Lim, G.K., Park, S.I., Kim, H.H., Koh, H.B., Cho, K.O. (2007) Detection and molecular characterization of calf diarrhoea bovine corona viruses circulating in south Korea DURING 2004-2005. Zoonoses Public Health. 54: 223-30. ##
Perez, E., Kummeling, A., Janssen, M.M., Jimenez, C., Alvarado, R., Cabal, M., Caballero, M., Donado, P., Dwinger, R.H. (1998) Infectious agents associated with diarrhea of calves in the canton of Tilarán, Costa Rica. Prev Vet Med. 33: 195-205.##
Quinn, P.J., Markey, B. K., Leonard, F. C., Hartigan, P., Fanning, S., FitzPatrick, E.S. (2002) Veterinary Microbiology and Microbial Disease. Blackwell Science Ltd. Iowa State University Press, Ames, Iowa, USA. p. 709.##
Reynolds, D.J., Morgan, J.H., Chanter, N., Jones, P.W., Bridger, J.C., Debney, T.G., et al. (1986) Microbiology of calf diarrhea in southern Britain. Vet Rec. 119: 34-39.##
Saif, L.J., Redman, D.R., Moorhead, P.D., Theil, K.W. (1986) experimentally induced coronavirus infections in calves: viral replication in the respiratory and intestinal tracts. Am J Vet Res. 47: 1426-1432.##
Schultze, B., Gross, H.J., Brossmer, R., Herrler, G. (1991) The S protein of bovine coronavirus is a hemagglutinin recognizing 9-O-acetylated sialic acid as a receptor determinant. J. Virol. 65: 6232-6237.##
Stipp, D.T., Barry, A.F., Alfieri, A.F., Takiuchi, E., Amude, A.M., Alfieri, A.A. (2009) Frequency of BCoV detection by a semi-nested PCR assay in faeces of calves from Brazilian cattle herds. Trop Anim Health Prod. 41: 1563-1567.##
Takiuchi, E., Stipp, D.T., Alfieri, A.F., Alfieri, A.A. (2006) Improved detection of bovine coronavirus N gene in faeces of calves infected naturally by a semi-nested PCR assay and an internal control. J Virol Methods. 131: 148-154.##
Tsunemitsu, H., Smith, D.R., Saif L.J. (1999) Experimental inoculation of adult dairy cows with bovine coronavirus and detection of coronavirus in feces by RT-PCR. Arch Virol. 144: 167-75.##
Uhde, F.L., Kaufmann, T., Sager, H., Albini, S., Zanoni, R., Schelling, E., Meylan, M. (2008) Prevalence of four enteropathogens in the feces of young diarrheic dairy calves in Switzerland. Vet Rec. 163: 362-366.##
Veslemøy, S.O., Madeleine, T., Stefan, A., Mette, M., Maria, S. (2016) Bovine coronavirus in naturally and experimentally exposed calves; viral shedding and the potential for transmission. Virol J. 13: 100.##