Document Type : Infectious agents- Diseases
Bovine respiratory disease is the most common illness affecting housed cattle worldwide (van Leenen et al., 2019). Several Mycoplasma species have been isolated from the bovine respiratory tract, including Mycoplasma bovis, Mycoplasma dispar, Mycoplasma bovirhinis, and Mycoplasma leachii (Becker et al., 2015; Spergser et al., 2019). Members of Mycoplasma, a genus of class Mollicutes, are free-living, self-replicating tiny prokaryotes (Parker et al., 2018) with no cell wall. These agents have the smallest known bacterial genome in the form of a single circular chromosome of double-stranded DNA (Becker et al., 2015).
These bacteria live generally as intracellular parasites close to the nucleus of their hosts (Szacawa et al., 2016).
The organism colonizes mucosal surfaces and produces several diseases, namely pneumonia, arthritis, otitis media, and meningitis, in calves, and mastitis and genital infections in adult cows (Schibrowski et al., 2018). Various factors, such as stress and simultaneous viral and bacterial infections (e.g., syncytial virus and Pasteurella multocida) have been reported as the predisposing factors for Mycoplasma infection (Bürki et al., 2015; Hay et al., 2014; Wisselink et al., 2019).
M. bovis is the second most pathogenic Mycoplasma that causes considerable economic losses in cattle, especially as calf pneumonia (Van Leenen et al., 2019). M. bovis has been detected in most countries throughout the world (Nicholas 2011) after the first detection as an etiologic agent of bovine mastitis in the USA (Hale et al., 1962). Similarly, the pathogen has been reported from different parts of Iran (Baharsefat and Yamini, 1968; Ghazaei, 2006; Dabiri et al., 2018; Imandar et al., 2018). M. dispar causes exudative bronchitis and pneumonia in calves, especially through the inhalation of contaminated aerosol and materials (Friis, 1980).
The amplification of specific genes by polymerase chain reaction (PCR) provides a fast and reliable way to detect Mycoplasma spp., compared to traditional methods, such as bacteriological culture (Hotzel et al., 1996; Chen et al., 2019).
Considering the lack of information on the state of mycoplasmal infection in the cattle population of the region, this study was carried out to detect Mycoplasmal infection in the lung tissue of cattle slaughtered in Hamedan industrial abattoir, Iran using PCR and histopathological examinations.
A total of 108 tissue samples (3×3×1 cm) were collected from the cranioventral regions of the cattle lungs during March 2015-February 2016 in Hamedan industrial abattoir regardless of the age, gender, breed, and origin of animals. The samples were placed in sterile plastic bags inside a cold box and were transported to the research laboratory of the Faculty of Veterinary, Bu-Ali Sina University, Hamadan, Iran. The tissue specimens were immediately cut into two pieces, one of which was placed in 10% neutral buffered formalin and the other piece being stored at -20ºC until further analysis.
Approximately 20 mg of each specimen was cut into small pieces aseptically and was utilized for DNA extraction by a commercial DNA extraction kit (Yekta Tajhiz Azma Co., Iran) according to the manufacturer’s manual. The purified DNA samples were stored in 1.5 mL microtubes at -70°C until evaluation by PCR. The DNA was also extracted from the Mycoplasma agalactiae vaccine (RaziVaccine and SerumResearchInstitute, Iran) to be used as a positive control in Mycoplasma genus PCR.
The extracted DNA samples were molecularly examined using the specific primers of Mycoplasma genus (GPF and MGSO) indicated in Table 1 (Lierz et al., 2007; Van Kuppeveld et al., 1994). The PCR mixture (20 μL) contained a commercial PCR Master Mix (10 μL), GPF primer (0.25 μL), MGSO primer (0.25 μL), target DNA (5 μL), and nuclease-free water (4.5 μL). The amplification settings entailed pre-denaturation at 94°C for 5 min, 35 cycles of denaturation at 94°C for 1 min, annealing at 55°C for 1 min, 72°C for 1 min, and a final extension step at 72°C for 10 min in a thermal cycler (ASTEC Co.,Fukuoka, Japan). Positive and negative controls were included in all PCR runs. Finally, 10 µL of the PCR products were electrophoresed on 1.5% agarose gel containing ethidium bromide (0.5 μg/mL) and visualized under the UV light utilizing a UV-transilluminator. A PCR product of 1013 bp in size was indicative of Mycoplasma genusmicroorganisms (Lierz et al., 2007).
Following the characterization of samples infected with Mycoplasma, the positive DNAs were tested for Mycoplasma species using nested and conventional PCR for M. bovis and M. dispar, respectively. As presented in Table 1, the outside PCR reactions used primers PpMB920-1 and PpMB920-2, while the inside one was carried out by primers PpSM5-1 and PpSM5-2 for M. bovis (Hotzel et al., 1993; Pinnow et al., 2001).
The nested PCR cycling parameters encompassed an initial denaturation step at 94°C for 11.5 min followed by 35 cycles of 94°C for 30 sec, primer annealing at 48°C for 60 sec, extension at 72°C for 150 sec, and a final step of 72°C for 10 min. A volume of 5 μL at a dilution of 1:100 of the outside PCR product was used as the template DNA in the second PCR reaction. The thermal conditions for the second PCR were almost similar to the outside PCR except for the annealing temperature which was 54°C. The total reaction volume of 25 μL had 12.5 μL of a commercial PCR Master Mix, 0.5 μL of each specific primer for M. bovis PCR 1 and 2, target DNA (5 μL), and nuclease-free water (6.5 μL). Afterwards, the PCR products were resolved by the same electrophoresis protocol as described above.
Samples devoid of the expected DNA for M. bovis species were tested for the genomic DNA of M. dispar using primers MDF and MDR demonstrated in Table 1 (Marques et al., 2007). The 25 μL PCR mixture included 12.5 μL of a commercial PCR Master Mix, 1 μL of each primer (50 pmol), 5.5 μL target DNA, and 5 μL nuclease-free water. The amplification process was carried out under the following condition: 94°C for 5 min, 94°C for 1 min, 53.6°C for 1 min, and 72°C for 1 min (35 cycles) along with a final cycle at 72°C for 5 min. The same procedure of agarose gel electrophoresis was applied to check PCR products.
Table 1. Primers used for the detection of Mycoplasma genus and species in PCR assays.
|
Primer* |
Sequence 5’-3’ |
Target |
Amplicon size (bp) |
Reference |
|
GPF MGSO |
GCTGGCTGTGTGCCTAATACA TGCACCATCTGTCACTCTGTTAACCTC |
Mycoplasma genus |
1013 |
Lierz et al., 2007 |
|
PpMB920-2 PpMB920-1 |
TTTTAGCTCTTTTTGAACAAAT GGCTCTCATTAAGAATGTC |
M. bovis |
1911 |
Hotzel et al., 1993 |
|
PpSM5-1 PpSM5-2 |
CCAGCTCACCCTTATACATGAGCGC TGACTCACCATTTAGACCGACTATTTCAC |
M. bovis |
442 |
Pinnow et al., 2001 |
|
MDF MDR |
TTAAAGCTCCACCAAAAA GTATCTAAAGCGGACTAAA |
M. dispar |
433 |
Marques et al., 2007 |
* All primers were purchased from BioNEER (South Korea).
Because of the unavailability of M. bovis and M. dispar standard strains as positive controls in PCR reactions, identification of these Mycoplasma species was performed by the sequencing of some PCR products (Bioneer, South Korea).
The formalin-fixed samples were dehydrated in ascending ethanol concentrations, cleared in xylene, infiltrated and embedded in paraffin, and sectioned at 5-6 µm thickness using a rotary microtome (Leica RM2255, Germany). The sections were then stained with hematoxylin and eosin (H&E) and were examined independently by a pathologist under a light microscope (Olympus CX41, Japan) equipped with a digital camera (Olympus DP25, Germany).
As shown in Figure 1, PCR assessment of lung tissue samples for Mycoplasma infection revealed that 9 (8.33%) out of 108 samples were contaminated with the DNA of Mycoplasma cells. Moreover, all these samples were investigated to determine Mycoplasma species. Afterwards, the 442 bp expected DNA fragment was tested in five Mycoplasma-positive samples by nested PCR indicating that these samples were infected by M. bovis. The results of the last PCR demonstrated that only one DNA sample was infected with M. dispar genomic DNA (Figure 1). The identity of the other three samples remained unknown.
The results of sequencing confirmed the identity of two characterized Mycoplasma species, namely M. bovis and M. dispar. The DNA fragment of 442 bp amplified from the M. bovis genome in this study showed ~99.5% homology, compared to sequences recorded in the GenBank with the accession number of CP038861.1. On the other hand, the blasting of the PCR product of 433 bp for M. dispar indicated ~99% homology with the corresponding segment of the bacterial 16S rRNA genome with an accession number of NR_025182.1.
Figure 1. The electrophoresed DNA fragments obtained from PCR reactions to identify Mycoplasma genus and species (M. bovis and M. dispar). Lane L: a 100 bp DNA ladder, lanes 1 and 2: a Mycoplasma-positive sample and M. agalactiae vaccine as positive control for the genus. Lanes 3 and 4: samples infected with M. bovis DNA. Lane 5: the only sample infected with M. dispar. Lane 6: a negative sample contained no DNA.
Microscopic lesions were found in 24 specimens out of 108 (22.22%) pulmonary tissue samples. Caseonecrotic lesions and inflammation sites of various sizes were found in the organ parenchyma of two samples (Figure 2A). Necrotic regions had a concentrated eosinophilic center surrounded by a zone of connective tissue infiltrated by inflammatory cells. Necrotic walls of alveoli and bronchioles were noted in the central area of the necrotic regions. Compressed neighboring alveoli, inflammatory cells, fibroblasts, as well as coagulative necrosis of airways and interstitial tissue were reported around the caseonecrotic regions. In 16 (14.81%) samples, interstitial pneumonia was observed with the thickening of alveolar walls, marked capillary congestion, mononuclear infiltration, and venous congestion of organ stroma (Figure 2B). Lobar bronchopneumonia along with the intense infiltration of neutrophils with fewer macrophages and plasma cells into bronchioles, alveolar ducts, and alveoli were found in three samples (2.77%). Coagulative necrosis of the tissue was noted with bronchial atelectasis, accumulation of purulent exudate in bronchioles and alveoli, and edema and fibrinous accumulation in alveolar ducts and alveolar sacs (Figure 2C). In three samples (2.77%), hyperplasia of lymphatic tissue around bronchioles was found concurrent with the thickening of bronchiolar walls and microvascular congestion (Figure 2D).
Figure 2. Light micrographs of pulmonary lesions of cattle infected with Mycoplasma spp
A. Caseonecrotic lesions in various size and shapes with an eosinophilic homogeneous center in the lung parenchyma (asterisk) nearby bronchioles (arrows). B. Interstitial pneumonia with thickening of alveolar walls and infiltration of mononuclear cells (arrow). C. Acute lobar bronchopneumonia with inflammatory cell infiltration of bronchioles (asterisk), alveolar ducts and alveoli together with edema and fibrinous exudate in the air sacs (arrow). D. Hyperplasia of bronchiolar associated lymphoid tissue along with thickening of the muscular layer of the bronchiole (asterisk).
A, C = x40, B = x400, D = x100
Hematoxylin and Eosin
Mycoplasmas are known to infect cattle worldwide. Several studies on the prevalence of Mycoplasma infection in calves have been conducted in Europe, Asia, and North America with results ranging from less than 5% to almost 100% (Becker et al., 2015; Schibrowski et al., 2018; Chen et al., 2019). These organisms have been frequently isolated from the respiratory tract of healthy cattle leading to some speculations about the pathogenicity of the agent (Blackburn et al., 2007). M. bovis causes chronic cranioventral bronchopneumonia characterized by caseous necrosis resulting in significant economic losses due to the costs of treatment and laboratory diagnosis, in addition to a decline in dairy and beef cattle production (Fulton, 2009).
In vitro culture of Mycoplasmas is difficult, time-consuming, and expensive often resulting in false-negative results (Waites et al., 2012). A histopathologic examination may show nonspecific lesions, and even, some animals may harbor the bacteria without developing enough pathological changes to exactly be pointed out under the microscope. On the other hand, molecular techniques, such as PCR offer high sensitivity and specificity for the diagnosis of microbial infections in specimens. Therefore, molecular methods are appropriate for detecting mycoplasmas in tissue samples difficult to culture.
Few studies have investigated mycoplasmal infections in cattle in Iran. However, only milk samples were examined in all these researches. Ghazaei (2006) tested 80 milk samples collected from dairy cows with clinical mastitis in the Moghan region of Ardabil, Iran using bacteriological culture and immunoperoxidase methods. The findings indicated that M. bovis was isolated from 39 (48.75%) samples (Ghazaei, 2006). In one study in Iran, bacteriological examination of bronchoalveolar lavage fluid resulted in the isolation of Mycoplasma from one (14.3%) healthy and four (28.6%) pneumonic calves under 3 months old (Araghi soureh et al., 2007). Imandar et al. (2018) performed a study based on bacteriological culture and 16S rRNA PCR on a panel of 328 milk samples collected from cows with clinical symptoms of mastitis from all regions of Iran. Their results indicated that out of 328 samples, 97 (29.57%) cases were infected with the bacteria ofgenus Mycoplasma, among which, 31 (31.97%) samples were identified as M. bovis species by PCR assay (Imandar et al., 2018). Dabiri et al. (2018) tried to detect M. bovis using nested PCR for 104 bulk tank milk samples in Mashhad, Iran. Although M. bovis was not identified in any of the specimens, the researchers characterized two Mycoplasma species, namely M. canadense and M. yeatsii by sequencing PCR products (Dabiri et al., 2018).
To our knowledge, the species M. dispar was identified in the present study for the first time in Iran. Located in the mountainous region of the country with a cold temperate, Hamedan is one of the main areas of breeding livestock, such as cattle in Iran. However, there is no documented data regarding the infection of cattle with Mycoplasma spp. in the region. Furthermore, M. bovis and M. dispar have not been detected in the lungs of cattle from Iran.
A total of 108 lung tissue samples were subjected to PCR and histopathologic examination for Mycoplasma infection. The results showed that nine (8.3%) specimens were positive for genus Mycoplasma. Nested PCR revealed that five and one of the positive samples were infected with M. bovis and M. dispar,respectively. This highlights the importance of M. bovis infection in cattle in Iran because over 50% of all identified Mycoplasma bacteria belonged to this species. The two-step nested PCR can detect even scarce target DNA molecules virtually as just a few copies with no cross-reactivity with the genomic DNA of other organisms. In the neighboring country of Turkey, the PCR examination of tracheal swab samples from cattle aged 6-12 months old and suffering from respiratory problems was positive with a mean of 12.6% (Babacan et al., 2014).
Large-scale epidemiological studies are needed to reveal the prevalence and distribution of Mycoplasma spp. particularly M. bovis and M. dispar in the cattle population of Iran. The results of the current study confirmed that the PCR technique shortens the time needed for identifying Mycoplasma in tissue, compared to the conventional bacteriological culture and histopathology methods. The latter one can depict typical and uncharacteristic lesions associated with Mycoplasma infection. However, exclusively PCR demonstrated the bacteria in the specimen, and bacteriological culture methods may not always successfully isolate these hard-to-culture bacteria. Furthermore, our results highlighted the need for applying appropriate preventive and control measures, such as implementing hygienic cattle farming and developing effective vaccines against Mycoplasma infection.
Based on the results of this study, it can be concluded that pulmonary infections by M. bovis and with a lesser grade M. dispar are present in the cattle population of west of Iran. As a result, this pathogen should be taken into consideration in case of respiratory problems in cattle. More investigations are required on the etiologic agents of respiratory conditions of cattle in the region.
The financial support was provided by Bu-Ali Sina University research grant. Appreciation goes to Dr. Aliasghar Bahari for his valuable help in designing the sampling methodology.
We also thank Miss Sakineh Azami and Mr. Behrooz Abbasabadi for their technical assistance.
The authors declare no conflict of interest.