Prevalence and Antibiotic Resistance Pattern of Mannheima haemolytica and Pasteurella multocida Isolated from Cattle Lung Samples from an Industrial Abattoir: A Study from Northeastern Iran

Document Type : Clinical Pathology

Authors

1 Department of Microbiology, Gorgan Branch, Islamic Azad University, Gorgan, Iran

2 Department of Biology, Gorgan Branch, Islamic Azad University, Gorgan, Iran

Abstract

 
BACKGROUND: Bovine respiratory disease (BRD) is still one of the most important infectious diseases in dairy farms. Pasteurella multocida and Mannheimia hemolytica are the main bacterial pathogens of BRD.

OBJECTIVES: This study aimed to determine the prevalence and pattern of antibiotic resistance of M. hemolytica and P. multocida isolated from lung samples of cattle slaughtered in an industrial abattoir in Golestan province, northeastern Iran.

METHODS: Samples were taken from diseased and normal-appearing lungs of cattle slaughtered in an industrial abattoir. The samples were processed bacteriologically for the isolation of both Pasteurellaceae species. The isolates were identified by cultural and biochemical tests, and polymerase chain reaction (PCR) technique. Antimicrobial susceptibility of the isolates was determined using the Kirby–Bauer disc diffusion method.

RESULTS: A total of 120 samples were collected. The bacteriological examination of the samples resulted in the isolation of 36 (30%) M. hemolytica and P. multocida strains. Of the isolates, 14 (11.6%) and 22 (18.3%) were positive for P. multocida and M. hemolytica, respectively. Clear difference was observed between the populations of M. haemolytica recovered from apparently healthy lung tissues versus pneumonia samples. All the isolates were susceptible to tulathromycin, and the highest resistance was observed to penicillin and erythromycin. Multiple drug resistance was observed in both Pasteurellaceae species.

CONCLUSIONS: The results highlight the importance of continued surveillance of BRD pathogens in monitoring their antibiotic resistance patterns to update treatment protocols. Surveillance studies are also necessary to develop policies for limiting the spread of resistance.

Keywords


Article Title [Persian]

فراوانی و الگوی مقاومت آنتی بیوتیکی Mannheima haemolytica وPasteurella multocida جدا شده از نمونه های ریوی گاو: مطالعه ای از شمال شرق ایران

Authors [Persian]

  • فاطمه اشرفی 1
  • آنیا آهنی آذری 1
  • لیلا فزونی 2
1 گروه میکروبیولوژی، دانشکدة علوم پایه، واحد گرگان، دانشگاه آزاد اسلامی، گرگان، ایران
2 گروه میکروبیولوژی، دانشکدة علوم پایه، واحد گرگان، دانشگاه آزاد اسلامی، گرگان، ایران
Abstract [Persian]

زمینه مطالعه: بیماری تنفسی گاو (BRD) همچنان یکی از بیماری‌های مهم در گاوداری‌ها می‌باشد. Pasteurella multocida و Mannheimia haemolytica پاتوژن‌های باکتریایی اصلی BRD هستند.
هدف: هدف از این مطالعه تعیین شیوع و الگوی مقاومت آنتی بیوتیکی M. hemolytica و P. multocida جدا شده از نمونه های ریه گاوهای یک کشتارگاه صنعتی واقع در استان گلستان، شمال شرق ایران، بود.
روش‌ کار: نمونه‌های ریه (شامل ریه‌های درگیر پنومونی و ظاهراً سالم) به ‌طور تصادفی از گاوهای کشتار شده در یک کشتارگاه صنعتی جمع‌آوری شد. نمونه ها برای جداسازی هر دو گونه Pasteurellaceae از نظر باکتریولوژیکی پردازش شدند. جدایه ها با آزمایش های کشت و بیوشیمیایی و تکنیک واکنش زنجیره ای پلیمراز (PCR) شناسایی شدند. حساسیت ضد میکروبی جدایه ها با استفاده از روش انتشار دیسک کربی-بائر تعیین شد.
نتایج: در مجموع 120 نمونه جمع آوری شد. بررسی باکتریولوژیک بر روی نمونه ها منجر به جداسازی 36 (30%) سویه M. hemolytica و P. multocida شد. از بین جدایه ها، 14 (11.6%) و 22 (18.3%) P. multocida و M. hemolytica مثبت بودند. تفاوت واضحی بین جمعیت M. haemolytica که از بافت‌های ظاهرا سالم ریه در مقابل نمونه‌های درگیر پنومونی بدست آمده بود مشاهده شد. تمامی جدایه ها به تولاترومایسین حساس بودند و بیشترین مقاومت به پنی سیلین و اریترومایسین مشاهده شد. MDR در هر دو گونه Pasteurellaceae مشاهده شد.
نتیجه‌گیری نهایی: نتایج بر اهمیت نظارت مستمر پاتوژن‌های BRD برای نظارت بر الگوهای مقاومت آنتی‌بیوتیکی آنها برای به‌روزرسانی پروتکل‌های درمانی تأکید می‌کند. مطالعات نظارتی نیز برای بکارگیری اقداماتی برای محدود کردن گسترش مقاومت ضروری خواهد بود.

Keywords [Persian]

  • فراوانی
  • گاو
  • مقاومت آنتی بیوتیکی
  • M. haemolytica
  • P. multocida

Introduction

Bovine respiratory disease (BRD) is still one of the most important infectious diseases in dairy farms. It is the main cause of economic loss due to animal death, low milk yield, reduction in weight gain and growth rates, as well as an increase in therapeutic costs and other economic measures (Nefedchenko et al., 2019). The economic burden of the disease is estimated to be around $1 billion in the United States alone (Lubbers & Hanzlicek 2013). Environmental stressors such as climate change, change in feed or housing, or transportation makes animals more susceptible to BRD caused by viral and bacterial agents (Hodgins et al., 2002). Pasteurella multocida, Mycoplasma bovis, Histophilus Somni, Arcanobacterium pyogenes, and Mannheimia hemolytica are considered as BRD bacterial pathogens. These commensal bacteria colonize bovine nasopharynx and cause infection when cattle are under stress (Confer AW, 2009).

  1. haemolytica is an opportunistic pathogen that is commonly isolated from the respiratory tract of healthy cattle. This organism, formerly known as Pasteurella haemolytica, is the main bacterial pathogen associated with BRD (Klima et al., 2014). P. multocida is another bacterial agent that causes BRD. This Gram-negative zoonotic bacterium can cause infection in domestic animals which can lead to significant economic losses.

In treatment of BRD in large commercial farms, the focus is on treating sick animals using metaphylactic antimicrobial therapy. The sick animals that do not respond to initial treatments are usually treated with another antimicrobial drug. Recently, treatment strategies for BRD have been investigated due to the observed antimicrobial resistance, especially multiple drug resistance (MDR) in isolates from cattle (Noyes et al., 2015).

Antimicrobial resistance, especially in isolates with MDR, has been reported by many researchers (Nefedchenko et al., 2019). Given the importance of BRD for animal husbandry economy and animal health, it is critical to gather more data on the prevalence and antimicrobial resistance of BRD-causative agents (Noyes et al., 2015).

Due to the limited data, this study aimed to determine the prevalence and pattern of antibiotic resistance of M. hemolytica and P. multocida isolated from lung samples of cattle slaughtered in an industrial abattoir in Golestan province, northeastern Iran.

Materials and Methods

Sample Collection

For this cross-sectional descriptive study, the lung samples were collected randomly from the cattle slaughtered in an industrial abattoir in Golestan province. Each sample was separately placed in a sterile ziplock plastic bag and transferred to the laboratory of Microbiology, Islamic Azad University, Gorgan Branch, not later than 2 hours after the animal`s death and stored cool not more than two days at 4oC until examination. From diseased samples, samples of 2-3 cm3 were taken from cranioventral lung lobes showing hyperemia, rough surface, and consolidation symptoms.

Bacterial Isolation and Identification

After homogenizing the samples in a sterile physiological solution, the suspension was cultured on blood agar supplemented with 5% defibrinated sheep blood and incubated at 37°C for 24 h. The colonies showing the morphology of M. haemolytica (white-grayish, medium-sized round, non-mucoid, and β-hemolytic) and P. multocida (non-hemolytic, greyish, medium-sized round, and non-mucoid) were selected. The suspicious colonies were streaked on blood agar and McConkey agar and incubated at 37°C for 24 h. Afterwards, the samples were tested for catalase and oxidase production and Gram staining reaction. In addition, TSI, SIM, urea agar, MRVP, nitrate, gelatin, simmons citrate agar, and culture media containing sugars such as glucose, arabinose, mannose, trehalose, ONPG, and NPG were used to identify the microorganisms. The cultures were incubated at 37°C for 24 h (Khalili et al., 2016; Nefedchenko et al., 2019). A narrow zone of hemolysis and growth on McConkey agar plate but unable to produce indole, was considered M. hemolytica (Al-Haj Ali and Al-Balla, 2019). While Gram-negative coccobacilli, catalase, oxidase and indole positive and citrate utilization, methyl red and VP tests, gelatin hydrolysis negative that did not grow on McConkey agar with no hemolysis on blood agar were considered P. multocida (Khamesipour et al., 2014).

Species Confirmation by PCR

Preliminary identification of the isolates was carried out by standard cultural and biochemical tests. PCR assay was used to confirm the isolates. The bacterial isolate was inoculated into the brain-heart infusion (BHI) broth and incubated at 37°C for 18-24 h. Genomic DNA was extracted from the isolated overnight culture using Geno Plus TM Genomic DNA Extraction Miniprep System (Viogene, China). The quality and quantity of the extracted DNA were determined by agarose gel electrophoresis (1%). The primers used to detect the species are displayed in Table 1 (Rawat et al., 2019).

 

 

Table 1. Primers used for detection of P. multocida and M. hemolytica

Microorganism

Gene

Primer Sequence

Amplicon size (bp)

M. hemolytica

PHSSA

F5`TTCACATCTTCATCCTC3`

R 5` TTTTCATCCTCTTCGTC3

327

P. multocida

KMT1

F5`ATCCGCTATTTACCCAGTGG3`

R5`GCTGTAAAGAACTCGCCAC3`

457

 

 

Amplification was carried out in a 25-μL total reaction volume containing 0.5-μLTaq DNA polymerase, 5 μL of 5× reaction buffer (Bioline, UK), 1 μL of each primer, 1 μL of template DNA, and 16.5 μL of DEPC water. The PCR amplification for PHSSA gene was done with 35 cycles of denaturation at 95°C for 1 min, annealing at 48°C for 1 min, and elongation at 72°C for 30 s. The initial denaturation and final extension were 95°C for 3 min and 72°C for 5 min, respectively. For amplification of the KMT1 gene, PCR was performed with 35 cycles of denaturation at 95°C for 45 s, annealing at 56°C for 45 s, and elongation at 72°C for 1 min. The initial denaturation and final extension were 95°C for 3 min and 72°C for 5 min, respectively (Rawat et al., 2019). The PCR products were detected by electrophoresis on a 1.5% agarose gel stained with Gel Red.

Antimicrobial Susceptibility Testing

Using the Kirby-Bauer disk diffusion method, the antimicrobial susceptibility testing of the isolates was performed according to the Clinical and Laboratory Standards Institute (CLSI, 2018) guidelines. The plates were incubated at 37°C for 18 h, and the results were interpreted after measuring the inhibition zone against each of the isolates. The antimicrobial agents (purchased from Padtanteb Company) including ceftiofur (30 μg), enrofloxacin (5 μg), florfenicol (30 μg), oxytetracycline (30 μg), spectinomycin (10 μg), tilmicosin (30 μg), tulathromycin (30 μg), erythromycin (30 μg), cotrimoxazole (1.25 μg), streptomycin (30 μg), ampicillin (30 μg), and penicillin (10 μg) were used in this study. The results were interpreted as resistant (R), intermediate (I), and susceptible (S) according to the criteria provided by the CLSI. Escherichia coli ATCC 25922 was used as the quality control strain for the interpretation of results (provided from Tehran University, Faculty of Veterinary Medicine).

Statistical Analysis

Differences in the bacterium isolation were determined by Chi-square test, and P-value≤0.05 was considered significant.

Results

A total of 120 lung samples, including apparently healthy (n=60) and those containing hepatization and consolidation in cranioventral lobes (n=60), were collected randomly from an industrial slaughterhouse in Golestan province during April to September 2020. The bacteriological examination of the samples resulted in the isolation of 36 (30%) M. hemolytica and P. multocida strains that were further confirmed by PCR technique. Of the isolates, 14 (11.6%) and 22 (18.3%) were positive for P. multocida and M. hemolytica, respectively. Eleven apparently healthy lungs were positive for both bacteria (Table 2). Significant difference was observed between the populations of M. haemolytica recovered from apparently healthy lung tissues versus diseased samples (P≤0.05), while no significant differences were found between the populations of P. multocida.

 

 

Table 2. Incidence of M. hemolytica and P. multocida in respiratory tract of apparently healthy and diseased lungs

Samples

Number of the samples

Number (percentage) of positive isolates for

P. multocida

M. hemolytica

Apparently healthy

60

6 (10)

5 (8.3)

Diseased

60

8 (13.3)

17 (28.3)

Total

120

14 (11.6)

22 (18.3)

 

 

 

In addition, other bacterial species such as Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus pneumonia, and E. coli were isolated and identified according to the phenotypic characteristics and biochemical tests.

Antimicrobial resistance profiles of the isolates are displayed in Tables 3 and 4. Based on the results, all the isolates were susceptible to tulathromycin. Resistance to erythromycin (55.5% of the isolates) was remarkable due to their importance in animal production and human health. Among the M. hemolytica isolates, the highest resistance was observed to penicillin, ampicillin, and erythromycin (54.5%). Of these isolates, 28.5% were MDR. In addition to tulathromycin, all the P. multocida isolates were susceptible to florfenicol and tilmicosin. In these isolates, the highest level of resistance was found to penicillin and erythromycin (57.1%), and 22.7% of the isolates were MDR.

  1. haemolytica and P. multocida isolates were further identified by the specific amplification of the PHSSA (327 bp) and KMT1 (457 bp) genes, respectively (Figures 1 and 2).

 

Figure 1. Amplification of KMT1 gene (457 bp) specific to Pasteurella multocida

 

Figure 2. Amplification of PHSSA gene (327 bp) of Mannheimia haemolytica

 

 

 

 

 

Table 3. Antimicrobial susceptibility testing of the M. hemolytica isolates against 12 antimicrobial agents

Antimicrobial Agents

Number (percentage) of isolates

Susceptible

Intermediate

Resistant

Ceftiofur

19 (86.3)

0 (0)

3 (13.6)

Enrofloxacin

18 (81.8)

0 (0)

4 (18.1)

Florfenicol

20 (90.9)

0 (0)

2 (9)

Oxytetracycline

16 (72.7)

1 (4.5)

5 (22.7)

Spectinomycin

19 (86.3)

0 (0)

3 (13.6)

Tilmicosin

20 (90.9)

0 (0)

2 (9)

Tulathromycin

22 (100)

0 (0)

0 (0)

Erythromycin

7 (31.8)

3 (13.6)

12 (54.5)

Co-trimoxazole

17 (77.2)

0 (0)

5 (22.7)

Streptomycin

18 (81.8)

0 (0)

4 (18.1)

Ampicillin

7 (31.8)

3 (13.6)

12 (54.5)

Penicillin

7 (31.8)

3 (13.6)

12 (54.5)

 

 

Table 4. Antimicrobial susceptibility testing of the P. multocida isolates against 12 antimicrobial agents

Antimicrobial Agents

Number (percentage) of isolates

Susceptible

Intermediate

Resistant

Ceftiofur

10 (71.4)

1 (7.1)

3 (21.4)

Enrofloxacin

12 (85.7)

0 (0)

2 (14.2)

Florfenicol

14 (100)

0 (0)

0 (0)

Oxytetracycline

11 (78.5)

0 (0)

3 (21.4)

Spectinomycin

7 (50)

2 (14.2)

5 (35.7)

Tilmicosin

14 (100)

0 (0)

0 (0)

Tulathromycin

14 (100)

0 (0)

0 (0)

Erythromycin

4 (28.5)

2 (14.2)

8 (57.1)

Co-trimoxazole

7 (50)

0 (0)

7 (50)

Streptomycin

11 (78.5)

1 (7.1)

2 (14.2)

Ampicillin

8 (57.1)

0 (0)

6 (42.8)

Penicillin

6 (42.8)

0 (0)

8 (57.1)

 

Discussion

 

Considering the role of M. hemolytica and P. multocida bacterial species in causing respiratory diseases in cattle, knowledge of their frequency and pattern of antibiotic resistance is of importance. In the present study, we aimed to isolate, identify, and monitor the antibiotic resistance of M. hemolytica and P. multocida isolated from lung tissue samples collected from an industrial slaughterhouse in Golestan province. Based on the results, out of 120 bovine lung samples, 30% were positive for P. multocida (11.6%) and M. hemolytica (18.3%), respectively. Different isolation rates have been reported by other researchers in and outside the country. In one study, the prevalence of M. haemolytica isolated from feedlot cattle over a 3-year period was reported 16.9% (Alexander et al., 2013). Moreover, in a study conducted in Syria, the highest rate of M. haemolytica isolation was 21.8% from pneumonic lung tissues (Al-Haj Ali and Al-Balla, 2019). In contrast with the present findings, Haji Hajikolaei et al. (2010) reported that 1.6% of the sampled cattle were positive for M. haemolytica in an abattoir in Ahvaz (Haji Hajikolaei et al., 2010). Based on a study by Khamesipour et al. (2014), 30 P. multocida strains were isolated from 333 pneumonic and apparently healthy slaughtered cattle (Khamesipour et al., 2014). Additionally, another study showed that all 12 studied pneumonic sheep lungs were positive for M. haemolytica (Kumar et al., 2015). In a study by Noyes et al. (2015), M. haemolytica was recovered from 29% of deep nasopharyngeal swabs (Noyes et al., 2015). In a study from India, 5 M. haemolytica and 3 P. multocida strains were isolated from 8 clinical cases. Moreover, both M. haemolytica and P. multocida were co-isolated from two lung tissue samples (Rawat et al., 2019). In line with the present work, the isolation rate of P. multocida from 175 lung, liver, and spleen samples was reported 10.3% by Sugun et al. (2016). In research by Valadan et al. (2014), out of 1454 samples, only 54 samples (3.71%) were positive for P. multocida (Valadan et al., 2014). Sahay et al. (2020) recovered 27 (7.2%) M. haemolytica and 28 (7.4%) P. multocida from 374 healthy and infected samples (Sahay et al., 2020).

According to the antimicrobial results, all the isolates were susceptible to tulathromycin, and the highest resistance was observed to penicillin and erythromycin. The sensitivity rates for M. haemolytica were between 31.8% (to penicillin, ampicillin, and erythromycin) and 100% (to tulathromycin), whereas sensitivity of the P. multocida isolates ranged from 28.5% (to erythromycin) to 100% (to tulathromycin, florfenicol, and tilmicosin). In a study conducted by Sebbar et al. (2019), the sensitivity rates of M. haemolytica to erythromycin and streptomycin were in line with our findings (Sebbar et al., 2019). In the present work, all the isolates were susceptible to tulathromycin while in a study by Timsit et al. (2017), high levels of resistance (>70%) to tulathromycin were reported in M. haemolytica and P. multocida isolates (Timsit et al., 2017). In our study, high resistance rate was observed to erythromycin (55.5% of the isolates) that was in agreement with the result of Anholt et al. (2017). In the current study, the ampicillin resistance rate was 54.5% for M. haemolytica, whereas it was reported 6% by Cassidy et al. (2014). In a similar study, the sensitivity rates of P. multocida to enrofloxacin and erythromycin were in line with those of our study (Khamesipour et al., 2014). Moreover, in a study carried out in Russia, the prevalence of antimicrobial resistance of M. haemolytica to ampicillin, streptomycin, and enrofloxacin was the same as our findings (Nefedchenko et al., 2019). In India, the resistance rates to penicillin, oxytetracycline, and streptomycin for both pathogens were similar to our findings (Sahay et al., 2020). Similarly, in a study from Mashhad, more than 90% of the M. haemolytica tested were susceptible to florfenicol (Mohammadi et al., 2006). In contrast to the present study, all P. multocida strains isolated from cattle and buffalo from Ahwaz were sensitive to cotrimoxazole (Gharibi et al., 2017).

In most studies including ours, high resistance rates of M. haemolytica to ampicillin and penicillin have been reported, whereas in a study from Mexico City, all the M. haemolytica strains were susceptible to these antimicrobials (Samaniego et al., 2011).

As seen here, the prevalence and antibiotic resistance pattern of M. haemolytica and P. multocida significantly varied in different studies. These differences may be due to the changes in climate, season, breeding, commercial practices, treatments, and management strategies of infected cattle (Ghadrdan Mashhadi et al., 2009).

Conclusion

In summary, the prevalence of M. haemolytica was more than that of P. multocida in the lung samples obtained from the apparently healthy and diseased cattle. In addition, clear difference was observed between the populations of M. haemolytica recovered from apparently healthy samples versus diseased samples. All the isolates were susceptible to tulathromycin, and the highest resistance was observed to penicillin and erythromycin. MDR was observed in both Pasteurellaceae species.

For the veterinarians, the results highlight the importance of constant monitoring of antibiotic resistance patterns of BRD pathogens to update treatment protocols. Surveillance studies are also necessary to develop strategies for limiting the spread of resistance.

 

Acknowledgments

This study was extracted from a dissertation performed by Fatemeh Ashrafi for a Master of Science degree in Microbiology. The Department of Microbiology, Islamic Azad University, Gorgan Branch is acknowledged for providing necessary laboratory facilities.

Conflict of Interest

The authors declared no conflicts of interest exist.

 

 

Alexander, T., Cook, SH., Klima, C., Topp, E., McAllister, T. (2013). Susceptibility totulathromycin in Mannheimia haemolytica isolated from feedlot cattle over a 3-year period. Frontiers in Microbiology, 4, Article 297. [DOI:10.3389/fmicb.2013.00297] [PMID] [PMCID]
Al-Haj Ali H., Al Balaa, B. (2019). Prevalence of Mannheimia haemolytica in Syrian Awassi sheep. Bulgarian Journal of Veterinary Medicine, 22(4), 439-446. [DOI:10.15547/bjvm.2123]
Anholt, RM., Klima, C., Allan, N., Matheson-Bird, H., Schatz, C., Ajitkumar, P., Otto SJG, S., Peters, D., Schmid, K., Olson, M., McAllister, T., Ralston, B. (2017). Antimicrobial Susceptibility of Bacteria That Cause Bovine Respiratory Disease Complex in Alberta, Canada. Frontiers in Veterinary Science, 4, 207. [DOI:10.3389/fvets.2017.00207] [PMID] [PMCID]
Clinical and Laboratory Standards Institute. (2018). M02: Performance standards for antimicrobial disk susceptibility tests (ISBN: 1-56238-835-5). Wayne, PA: Clinical and Laboratory Standards Institute; USA.
Confer, AW. (2009). Update on bacterial pathogenesis in BRD. Animal Health Research Reviews, 10(2), 145-8. [DOI:10.1017/S1466252309990193] [PMID]
Ghadrdan Mashhadi, A.R., Asgari Badouei, M., Safarin Dastjerdehei, H., Ashrafi tamay. (2009). A survey on role of Mannheimia haemolytica in Sheep Pneumonia in Garmsar. Journal of Veterinary Microbiology, 5(2), 107-110
Gharibi, D., Haji Hajikolaei, M.R., Ghorbanpour, M., Barzegar, S.K. (2017). Isolation, Molecular Charact-erization and Antibiotic Susceptibility Pattern of Pasteurella multocida Isolated from Cattle and Buffalo from Ahwaz, Iran. Archives of Razi Institute, 72(2), 91-98.
Haji Hajikolaei, M. R., Ghorbanpour, M., Seyfiabad Shapouri, M., Rasooli, A., Ebrahimkhani, D., Jabbari, A. R. (2010). Bacteriological and serological studies on Mannheimia haemolytica infection in cattle slaughtered at Ahvaz (southwestern Iran) abattoir. Iranian Journal of Veterinary Research, Shiraz University, 11(1), 30, 84-87.
Hodgins, D. C., Conlon, J. A., & Shewen, P. E. (2002). Respiratory viruses and bacteria in cattle. Polymicrobial Diseases, 213-229.
Khalili, I., Ghadimipour, R., Ghaderi, R., Shokri, GH. Jabbari, A.R., Razmaraii, N., Ebrahimi, M. (2016). Isolation, identification, and monitoring of antibiotic resistance in Pasteurella multocida and Mannheimia haemolytica isolated from sheep in East Azerbaijan province, Iran. Archives of Razi Institute, 71(3), 153-160.
Khamesipour, F., Momtaz, H., & Azhdary Mamoreh, M. (2014). Occurrence of virulence factors and antimicrobial resistance in Pasteurella multocida strains isolated from slaughter cattle in Iran. Frontiers in Microbiology5, 536. [DOI:10.3389/fmicb.2014.00536] [PMID] [PMCID]
Klima, C. L., Alexander, T. W., Hendrick, S., & McAllister, T. A. (2014). Characterization of Mannheimia haemolytica isolated from feedlot cattle that were healthy or treated for bovine respiratory disease. Canadian Journal of Veterinary Research78(1), 38-45.
Kumar, J., Dixit, S. K., & Kumar, R. (2015). Rapid detection of Mannheimia haemolytica in lung tissues of sheep and from bacterial culture. Veterinary World, 8(9), 1073. [DOI:10.14202/vetworld.2015.1073-1077] [PMID] [PMCID]
Lubbers, B. V., & Hanzlicek, G. A. (2013). Antimicrobial multidrug resistance and coresistance patterns of Mannheimia haemolytica isolated from bovine respiratory disease cases—a three-year (2009–2011) retrospective analysis. Journal of Veterinary Diagnostic Investigation, 25(3), 413-417.               [DOI:10.1177/1040638713485227] [PMID]
Abbas Panah, H., Ghazvini, K., & Mohammadi, G. R. (2006). Antimicrobial susceptibility testing of Mannheimia haemolytica and Pasteurella multocida isolated from calves with dairy calf pneumonia. Archives of Razi Institute, 61(2), 91-96.
Nefedchenko, AV., Glotova, TI. , Glotovo, AG. (2019). Isolation and antimicrobial resistance of Mannheimia haemolytica on dairy farms in Siberia. Bulgarian Journal of Veterinary Medicine, 22 (4), 428-438. [DOI:10.15547/bjvm.2123]
Noyes, N.R., Benedict, K.M., Gow, S.P., Booker, C.W., Hannon, S.J., McAllister, T.A., Morley, P.S. (2015). Mannheimia haemolytica in Feedlot Cattle: Prevalence of Recovery and Associations with Antimicrobial Use, Resistance, and Health Outcomes. Journal of Veterinary Internal Medicine, 29,705-713.        [DOI:10.1111/jvim.12547] [PMID] [PMCID]
Rawat, N., Gilhare, VR., Kushwaha, KK., Hattimare, DD., Khan, FF., Shende, RK., & Jolhe, DK. (2019). Isolation and molecular characterization of Mannheimia haemolytica and Pasteurella multocida associated with pneumonia of goats in Chhattisgarh. Veterinary World, 12(2), 331-336. [DOI:10.14202/vetworld.2019.331-336] [PMID] [PMCID]
Sahay, S., Natesan, K., Prajapati, A., Kalleshmurthy, T., Shome, BR., Rahman, H., & Shome, R. (2020) Prevalence and antibiotic susceptibility of Mannheimia haemolytica and Pasteurella multocida isolated from ovine respiratory infection: A study from Karnataka, Southern India. Veterinary World, 13(9), 1947-1954. [DOI:10.14202/vetworld.2020.1947-1954] [PMID] [PMCID]
Jaramillo-Arango, C. J., Aguilar-Romero, F., Navarrete, J. V., Hernández-Castro, R., & Tavera, F. T. (2012). Antimicrobial resistance in Mannheimia haemolytica strains isolated from dairy cattle nasal exudate. Veterinaria México, 43(2), 123-132.
Sebbar, G., Zro, K., YAHIA, K. I. S., & ELOUENNASS, M. (2019). Antimicrobial susceptibility screening test of mannheimia haemolytica and pasteurella multocida (serogroup a) moroccan strains isolated from ruminants.  Bulgarian Journal of Veterinary Medicine, 2019-0109. [DOI:10.15547/bjvm.2019-0109]
Timsit, E., Hallewell, J., Booker, C., Tison, N., Amat, S., & Alexander, T. W. (2017). Prevalence and antimicrobial susceptibility of Mannheimia haemolytica, Pasteurella multocida, and Histophilus somni isolated from the lower respiratory tract of healthy feedlot cattle and those diagnosed with bovine respiratory disease. Veterinary Microbiology, 208, 118-125.         [DOI:10.1016/j.vetmic.2017.07.013] [PMID]
Valadan, M., Jabbari, A. R., Niroumand, M., Tahamtan, Y., & Bani Hashemi, S. R. (2014). Isolation and identification of Pasteurella multocida from sheep & goat in Iran. Archives of Razi Institute69(1), 47-55.