Iranian Journal of Veterinary Medicine

Iranian Journal of Veterinary Medicine

Identification and Discrimination of Salmonella Enteritidis, S. Pullorum, S. Gallinarum and S. Dublin Using Salmonella Specific Genomic Regions Amplification Assay

Document Type : Infectious agents- Diseases

Authors
1 Department of Animal Source, Faculty of Agriculture, University of Al-Qasim Green, Iraq
2 Department of Microbiology and Immunology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran
Abstract
Background: DNA amplification method has been developed for identifying and discriminating Salmonella serovars, using specific primers at the genus and serovar levels and to identify the S. Enteritidis, S. Dublin, S. Gallinarum and S. Pullorum.
Objectives: This study was conducted for molecular identification and discrimination among some important Salmonella serovars.
Methods: Fifty isolates of Salmonella were assayed. The PCR assay was designed to amplify DNA fragments from six Salmonella genes, invA (284 bp), tcpS (882 bp), lygD (339 bp), flhB (155 bp), SlgC (252 bp), and speC (174 bp).
Results: The results showed invA and tcpS genes presence in all four Salmonella serovars, whereas the lygD gene only exists in S. Enteritidis and is not found in S. Dublin, S. Gallinarum and S. Pullorum. The flhB gene is only present in S. Enteritidis and S. Dublin whereas it does not exist in S. Gallinarum and S. Pullorum. The SlgC gene exists in both S. Gallinarum and S. Pullorum, the SpeC gene is specifically present in S. Gallinarum, whereas SlgC and SpeC genes are not found in S. Enteritidis and S. Dublin. Salmonella Dublin serovar amplification assay successfully identified three selected serovar specific genomics regions (SSGRs) and hut gene. The results identify hut gene (495 bp), DSR1 (Dublin-specific genomics region1) (105 bp), DSR2 (Dublin-specific genomics region2) (203 bp), and DSR3 (Dublin-specific genomics region3) (296 bp).
Conclusions: Amplification techniques on Salmonella serovars specific genomics regions are able to identify and discriminate clinically significant Salmonella serovars, and therefore, have the possibility to be used as a useful and rapid screening assay and support conventional biochemical and serological examinations
Keywords

Salmonellosis is a considerable public health concern and important disease resulting in increased morbidity and mortality of affected poultry, animals and foodstuff as well as high cost of treatment, cause the majority of cases universally each year. Salmonella is a genus of Gram-negative, facultative anaerobic, rod-shaped bacteria of the family Enterobacteriaceae. Members of this genus are motile by peritrichous flagella except Salmonella Pullorum and Salmonella Gallinarum. Presently there are two recognized species, Salmonella bongori and Salmonella enterica which consist of six subspecies (Grimont and Weill, 2007; Issenhuth-Jeanjea et al., 2014).

Salmonella serovars are of particular concern to the poultry, animals and foodstuff. The most frequent and epidemiological important serovars are S. Enteritidis, S. Dublin, S. Gallinarum and S. Pullorum. Salmonella Enteritidis is one of the two most frequent etiological agents of human food borne salmonellosis. Contaminated poultry products are the main vehicle of S. Enteritidis ranging from 29% to 34% of all Salmonella infections (Henriques et al., 2013; Linam and Gerber, 2007) and are responsible for causing the highest number of bacterial foodborne infections in the United States (Scallan et al., 2011). Salmonella Enteritidis is a major serovar associated with human salmonellosis and is related to consumption or handling of contaminated poultry products, including eggs (Much et al., 2009). Salmonella infections are widespread internationally in both developed and developing countries and are effective reasons of the morbidity and economic loss (Zahraei Salehi et al., 2007).

Salmonella Dublin is the most commonly encountered Salmonella serovar in cattle and cattle products in many parts of the world (Uzzau et al. 2000). The prevalence of Salmonella in beef and milk products in Iran is low compared to products of other animal food sources such as poultry. Acquiring an infection in human from bovine origin foods is much lower than poultry products. Salmonella Dublin is one of the few hosts-adapted serovars also known to occasionally cause severe infections in humans (Uzzau et al. 2000). Salmonella Dublin infections have been demonstrated to lead to a significantly higher mortality in humans compared to infections caused by S. Typhimurium and S. Enteritidis (Jones et al. 2008), therefore considerable attention must be paid to control of S. Dublin infections of cattle.

Salmonella Pullorum and S. Gallinarum are very similar phenotypically. They are the agents of Pullorum disease which causes white diarrhea in young chickens and fowl typhoid, respectively. These two diseases are responsible for economic losses in the poultry production industry (Shivaprasad et al., 2013). Although S. Pullorum and S. Gallinarum are difficult to differentiate in routine laboratory procedures due to their high level similarities in their antigenic characteristics, the differentiation among four Salmonella serovars is very significant both from an epidemiological viewpoint and in relation to controlling programs (Soria et al., 2012).

White–Kauffmann–Le Minor scheme enables the classification of the genus Salmonella in more than 2,600 serovars (Ranieri et al. 2013) using the combination of somatic (O) and flagellar (H) antigens (Majchrzak et al. 2014). Salmonella Enteritidis, S. Dublin, S. Gallinarum and S. Pullorum are characterized as Salmonella enterica sub species enterica serovars, which are known as group D (somatic antigens 1, 9, 12) and show antigenic similarities. Both S. Enteritidis and S. Dublin have flagellar antigen (H1) and do not have flagellar antigen (H2). However, the differentiation between S. Gallinarum and S. Pullorum is still not possible serologically; they do not have flagella and flagellar antigens. Conventional methods are laborious, expensive and time-consuming, so alternative methods have been developed, such as a simple, inexpensive accurate and fast PCR assay to identify and discriminate among Salmonella serovars (Karns et al. 2015).

In the present study, Salmonella serovars were identified based on their specific genomic region amplification using distinct target DNA sequences determined by polymerase chain reaction (PCR), Salmonella enterica serovars S. Enteritidis, S. Dublin S. Pullorum and S. Gallinarum were specifically identified and discriminated by amplification PCR according to the presence  of invA, tcpS, lygD, flhB, SlgC and speC genes, as well as hut gene and also 3 Dublin specific genomic regions: DSR1, DSR2 and DSR3 were employed to identify S. Dublin which were located on serovars specific genomic regions (SSGRs) (Akiba et al. 2011).

The invA has been recognized as a universal standard for detection of Salmonella genus and has exemplified as adequate target with possible diagnostic applications (Salehi et al. 2005), lygD gene has been found only in S. Enteritidis and could be used to distinguish these serovars, specifically (Zhu et al. 2015).  flhB gene can be used to detect S. Gallinarum and S. Pullorum, which lack this specific region  compared with S. Enteritidis and S. Dublin which have flhB gene (Xiong et al. 2016).  The tcpS gene has been found in S. Enteritidis, S. Dublin, S. Gallinarum and S. Pullorum (Xiong et al. 2017).

Polymerase chain reaction (PCR) assay is a reliable method to identify and differentiate between biovars S. Gallinarum and S. Pullorum by means of target regions of SlgC and speC genes (Barrow and Neto 2011; Ribeiro et al. 2009).

The main goal of this study was to identify and discriminate of S. Enteritidis, S. Dublin, S. Gallinarum and S. Pullorum using invA, tcpS, lygD, flhB, SlgC and speC genes. Also, hut gene and a serovar specific genomic region (SSGRs) for S. Dublin were employed in multiplex PCR to detect this serovar specifically. This study was conducted in 2017 for molecular identification and discrimination among some important Salmonella serovars.

Materials and Methods

Sample collection: Obtained out on fifty Salmonella isolates from the collection of Department of Microbiology, Faculty of Veterinary Medicine, University of Tehran, these samples were isolated from chicken (37 samples), calves (10 samples) and foodstuffs (5 samples).

Isolation and Identification: All isolates were confirmed as Salmonella using both morphological and biochemical assays (Quinn et al. 2011). Afterwards the samples were inoculated in the brain heart infusion broth and incubated at 37 °C for 24 h, then were transferred to Luria Bertani (LB) agar and after 24 h bacterial colony was harvested.

Serotyping: Fifty biochemically identified Salmonella isolates were identified serologically according to the White–Kauffmann–Le Minor scheme (Swayne, 1998). Salmonella isolates were serotyped by slide agglutination test for determining somatic antigen (O) and tube agglutination test for determining the flagellar antigens (H) using Salmonella polyvalent and monovalent antisera (BIORAD, Difco, USA).

DNA extraction: After 24 h incubation in LB media, bacterial colony was harvested and DNA was extracted using the boiling method  as described before(Swayne 1998). The DNA extract was divided into aliquots and kept at −20 °C until using as PCR template.

Optimization of primers and DNA amplification: Protocols of each PCR reaction were designed and programmed for each pair of primers according to annealing temperatur es using Thermal Cycler (Bio-Rad, Hercules, California, USA) as mentioned in the Tables (1 and 2). The PCR was performed with a total volume of 25 μl that consists of a 10 μl master mix (Sinaclon, Bioscience, Iran), 1 μl (100 pmol) of each forward and reverse primer, 2 μl of template DNA and nuclease-free water up to 25 μl.  Sterile nuclease free water was used instead of DNA as a negative PCR control. The PCR products were electrophoresed in 1.5% agarose gel (Fermentas) for 1 h at 100 V; the gels were stained with ethidium bromide (2 μg per ml) for 15 min. The product size was measured using 100 bp DNA Ladder (Sinaclon, Bioscience, Iran). The gel was photographed by a gel documentation system for visualized fluorescent bands.

Results

All fifty Salmonella samples isolated from chicken, calves and foodstuff were identified biochemically and serologically. All of the isolates revealed the expected biochemical characteristics. Serotyping was used to identify the serogroup and serotype based on the somatic and flagellar antigens as both S. Enteritidis and S. Dublin have flagellar antigen (H1) and do not have flagellar antigen (H2). Salmonella Gallinarum and S. Pullorum do not have flagella and flagellar antigens (H1, H2). Thirty-seven samples were identified as Salmonella Enteritidis, 9 samples were identified as S. Dublin, while 2 samples were identified as S. Gallinarum and 2 samples were identified as S. Pullorum. Identification was confirmed by PCR assay. All Salmonella serovars showed positive results using primers related to invA and tcpS genes and showed positive bands at 284 and 882bp respectively, the PCR results indicated that S. Enteritidis revealed four specific bands for tcpS, invA, lygD and flhB genes in 882, 284, 339 and 155 bp respectively, S. Dublin revealed three specific bands for tcpS, invA and flhB genes at 882, 284 and155 bp respectively and was negative for lygD gene. Salmonella Pullorum and S. Gallinarum serovars revealed two specific bands for tcpS and invA at 882 and 284 bp and were negative for lygD and flhB genes (Fig.1). It is not possible to differentiate between S. Pullorum and S. Gallinarum by lygD and flhB related primers and these primers only are able to differentiate between S. Enteritidis and S. Dublin (Fig.1). The PCR assay could differentiate between S. Enteritidis and the other three serovars by revealing a specific band for lygD gene at 339 bp which exists only in S. Enteritidis and is not found in the others. S. Enteritidis and S. Dublin PCR results revealed a specific band at 155 bp for flhB gene, which is not present in S. Gallinarum and S. Pullorum PCR products (Fig. 1). Salmonella Gallinarum and S. Pullorum PCR result in (Fig. 2) indicates a specific band at 252 bp for SlgC gene, which exists in S. Gallinarum and S. Pullorum and is not present in S. Enteritidis and S. Dublin. A specific primer pair for speC gene was employed, which showed the specific band at 174 bp exists only in S. Gallinarum and is not found in the three other serovars (Fig.2). Therefore, the PCR assay detected fifty Salmonella serovars, the results showed that S. Enteritidis indicated four specific bands for tcpS, invA, lygD and flhB genes (882, 284, 339 and 155 bp). S. Dublin indicated three specific bands for tcpS, invA and flhB genes (882, 284 and 155 bp), S. Pullorum indicated three specific bands for tcpS, invA and SlgC genes (882, 284 and 252 bp), whereas,  S. Gallinarum showed four specific bands for tcpS, invA, SlgC and speC genes (882, 284, 252 and 174 bp) respectively, differentiating between S. Gallinarum and S. Pullorum (Table 3). In the present study, three SSGRs from S. Dublin and also hut gene were selected as target regions for the m-PCR assay based on their predominance in dairy cows and calves, all target regions indicated positive bands of SSGRs for DSR1, DSR2 and DSR3 (105, 203 and 296 bp) and hut gene (495 bp) which are shown in (Fig.3).

Table 1. Primers used in PCR for detecting S. Enteritidis, S. Pullorum, S. Gallinarum and S. Dublin with amplification protocol (Fig. 1 and 2).

Primers

Target   gene

Length

Sequence(5´-3´)

Product   size(bp)

References

tcpS-F

tcpS

21

ATGTCTATAAGCACCACAATG

882

(Xiong et al. 2017)

tcpS-R

tcpS

22

TCATTTCAATAATGATTCAAGC

882

 

lygD-F

lygD

28

CATTCTGACCTTTAAGCCGGTCAATGAG

339

(Xiong et al. 2017)

lygD-R

lygD

29

CCAAAAAGCGAGACCTCAAACTTACTCAG

339

 

     ST139-F

invA

26

GTGAAATTATCGCCACGTTCGGGCAA

284

(Rahn et al. 1992)

ST141-R

invA

22

TCATCGCACCGTCAAAGGAACC

284

 

FlhBinner-F

flhB

27

GCGGACGTCATTGTCACTAACCCGACG

155

(Xiong et al. 2016)

FlhBinner-R

flhB

27

TCTAAAGTGGGAACCCGATGTTCAGCG

155

 

SGP-F

SlgC

18

CGGTGTACTGCCCGCTAT

252

(Kang MS 2011)

SGP-R

SlgC

17

CTGGGCATTGACGCAAA

252

 

SG-F

speC

18

GATCTGCTGCCAGCTCAA

174

(Kang MS 2011)

SG-R

speC

19

GCGCCCTTTTCAAAACATA

174

 

 

 

                                                                     Amplification protocol (1) for (Fig.1)

 

Primary   denaturation

denaturation

annealing

elongation

Latest   elongation

No .of   cycles

94°C

94°C

55°C

72°C

72°C

29

5 min

45 s

45 s

1 min

10 min

 

 

 

Amplification   Protocol (2) for (Fig.2)

 

Primary   denaturation

denaturation

annealing

elongation

Latest   elongation

No .of   cycles

94 °C

94 °C

56°C

72°C

72°C

32

4min

45s

30s

45s

10min

 

                       

 

 

 

Table 2. Primers used in PCR for detecting Salmonella Dublin and amplification Protocol (Fig.3).

 

 

Primers

Target gene

Length

Sequence (5´-3´)

 Product   size(bp)

References

Hut-F

hut

25

ATGTTGTCCTGCCCCTGGTAAGAGA

495

(Cohen   et al. 1993)

Hut-R

hut

24

ACTGGCGTTATCCCTTTCTCTGCTG

495

 

DMP3-F

DSR3

20

ATCACCCTCGCAAACTTGTC

296

(Akiba   et al. 2011)

DMP3-R

DSR3

20

TCGGGCAATCAGGTCGCCGA

296

 

DMP2-F

DSR2

20

ACGCGAAATCTGATGGTCTT

203

(Akiba   et al. 2011)

DMP2-R

DSR2

20

GCCCACCAGTTGTGAAAGGC

203

 

DMP1-F

DSR1

20

ATCGGTGCTGGGTAATTTTG

105

(Akiba   et al. 2011)

DMP1-R

DSR1

20

AGGAACGAGAGAAACTGCTT

105

 

Amplification protocol (Fig3)

 

Primary denaturation

denaturation

annealing

elongation

No .of cycles

94 °C

98°C

60°C

68°C

35

2 min

10s

30s

30s

 

Table-3: Amplification results for S. Enteritidis, S. Dublin, S. Gallinarum and S. Pullorum.

 

Primers

Target gene

Size(bp)

S.E

S.D

S. G

S. P

tcpS-F

tcpS- R

tcpS

882

+

+

+

+

lygD-F           lygD- R

lygD

339

+

-

-

-

ST139-F         ST141-R

invA

284

+

+

+

+

FlhBinner-F  FlhBinner R

flhB

155

+

+

-

-

SGP-F            SGP-R

SlgC

252

-

-

+

+

SG-F               SG-R

speC

174

-

-

+

-

 

 

Discussion

Salmonella has been identified as an  important threat to the public health throughout the world,  Salmonella continues to exist in the most predominant serious causes of food borne pathogens (Crim et al. 2014). There are several techniques defined globally as standard procedures for detecting and monitoring different Salmonella serovars (Whyte et al. 2002). These procedures are time-consuming and expensive and require specialized technicians. These procedures such as morphological characterization, biochemical tests and serological examinations may not produce  completely acceptable results (Persson et al. 2012)  and have much lower sensitivity compared to molecular  assays (Oliveira et al. 2002).

Molecular assays are more appropriate, convenient and efficient than conventional techniques.  Amplification assay is an easy tool, a rapid and precise device to identify different  Salmonella serovars and has been concerned in  the last decades (Karns et al. 2015; Persson et al. 2012). In the present study the invA gene is used for diagnosis of all Salmonella serovars, the results show specific bands at 284 bp which were in agreement with the previous studies’ results (Borges et al. 2013; Salehi et al. 2005). The results also indicated that four understudy Salmonella serovars were positive for tcpS gene  specific bands appearing at 882 bp in all Salmonella serovars (Xiong et al. 2017). Also, the results revealed that PCR is able to differentiate among S. Enteritidis and other Salmonella serovars S. Dublin, S. Pullorum and S. Gallinarium showing the specific band at 339 bp due to the lygD gene exists only in S. Enteritidis (Xiong et al. 2017; Zhu et al. 2015). lygD gene in SDF locus has been found only in S. Enteritidis and could be used to distinguish these serovars specifically, the SDF is located on the chromosomes that were used to screen S. Enteritidis genomic library and a unique region was defined. Besides, the m-PCR results revealed specific bands at 155 bp in S. Enteritidis and S. Dublin, which did not exist in S. Pullorum and S. Gallinarum. The flhB gene could be utilized to identify S. Gallinarum and S. Pullorum from other serovars S. Enteritidis and S. Dublin due to individual region being located only in these serovars. The flhB gene is a highly conserved component of the flagellar secretion system (Meshcheryakov et al. 2013), and it plays an important role in the determination of flagellar hook length and regulation of protein export (Hirano et al. 1994). Most Salmonella species possess flagella and exhibit motility. However, S. Pullorum and S. Gallinarum are two notable exceptions  that have  shown lack of motility and flagella (Holt and Chaubal 1997). Thus, the flhB gene of S. Pullorum/Gallinarum may own some special features that are different from other serovars. This finding was in agreement with previous study (Xiong et al. 2016). SpeC and SlgC genes are pseudogenes and are continually created from ongoing mutational process and are subjected to degradation and removal by further accumulation of mutations, the retention time seems to be extremely short, even in very closely related bacteria. Our multiplex PCR results  indicated amplified fragments of the slgC and speC genes and this provides a highly powerful distinction between S. Gallinarum and S. Pullorum. Salmonella Pullorum does not produce amplicon from speC gene and S. Gallinarum produces amplicon from slgC and speC genes; moreover, speC gene exists in S. Gallinarum, whereas slgC gene exists in both S. Gallinarum and S. Pullorum genome, but is not found in other Salmonella serovars, and these results were in agreement with the previous studies (Ribeiro et al. 2009; Li et al. 2007;(Kang MS 2011).

The screenings are requested for rapid and suitable assay to identify S. Pullorum; just as in the previous studies, it was concluded that traditional DNA based techniques are not convenient due to high similarities in the genome  sequence of S. Gallinarum and S. Pullorum (Batista et al. 2015; Feng et al. 2013). It is difficult to immediately differentiate between biovars by serological and biochemical assays, because they belong to the same serogroup, and they do not have flagella. The diagnostic value of biochemical traits is commonly combined with serological characterization, the whole method requires several days and is likely to be replaced by molecular methods to discriminate between these biovars  (Rubio et al. 2017).

In the present study, primers of six Salmonella genes, tcpS, lygD, invA, flhB, SlgC and speC were employed to identify and properly differentiate among Salmonella. Enteritidis, S. Dublin, S. Gallinarium and S. Pullorum  permit the evolution of dependable and rapid m-PCR assay to screen and reveal these important four Salmonella serovars.

On the other hand, the serovar specific genomic regions (SSGRs) were targeted to identify S. Dublin, these selected genomic regions are extremely predominant among Salmonella serovars. The best primers utilized to reveal the SSGRs are related to the hut, DSR1, DSR2 and DSR3 genes. The Hut gene is a segment of the knowing histidine transport operon of Salmonella and this gene was selected because it was considered to be highly conserved among Salmonella serovars, and  is responsible for regulation of histidine as a source of carbon, energy, and nitrogen. It was concluded that three (SSGRs) perhaps give adequate specificity to the PCR assays used to identify S. Dublin and this finding is in agreement with  another study (Akiba et al. 2011). Furthermore, this PCR assay (SSGRs) could further improve the serovar discrimination and the detection limit comparable to solely biochemical and serological tests.

Conclusion: The application of PCR assay was investigated by checking for four prominent Salmonella serovars isolated from chicken, calves and foodstuffs. The results indicated the feasibility of utilizing the amplification assay to rapidly screen in and differentiate among Salmonella serovars and appears to be a suitable technique compared to the conventional methods, furthermore, the integration between conventional techniques and PCR assay would enhance the efficacy of identification and discrimination among Salmonella serovars.

Acknowledgments

This work was supported by the University of Tehran, Faculty of Veterinary Medicine, grant No.7504002. The authors would like to thank, Mr. Iradj Ashrafi Tamai for the cooperation in the laboratory process.

Conflicts of interest

The author declared no conflict of interest.

Akiba, M., Kusumoto, M., Iwata, T. (2011). Rapid identification of Salmonella enterica serovars, typhimurium, choleraesuis, infantis, hadar, enteritidis, dublin and gallinarum, by multiplex PCR. J Microbiol Methods, 85,9-15. https://doi.org/10.1016/j.mimet.2011.02.002
Barrow, P., Neto, O.F. (2011). Pullorum disease and fowl typhoid—new thoughts on old diseases: a review. Avian pathol, 40,1-13. https://doi.org/10.1080/03079457.2010.542575
Batista, D.F.A., Neto, O.C.F., Barrow, P.A., de Oliveira, M.T., Almeida, A.M., Ferraudo, A.S., Berchieri, J.r. A. (2015). Identification and characterization of regions of difference between the Salmonella Gallinarum biovar Gallinarum and the Salmonella Gallinarum biovar Pullorum genomes. Infect Genet Evol, 30,74-81. https://doi.org/10.1016/j.meegid.2014.12.007
Borges, K.A., Furian, T.Q., Borsoi, A., Moraes, H.L., Salle, C.T., Nascimento, V.P. (2013). Detection of virulence-associated genes in Salmonella Enteritidis isolates from chicken in South of Brazil. Pesqui Vet Bras,33,1416-1422. http://dx.doi.org/10.1590/S0100-736X2013001200004
Cohen, N.D., Neibergs, H.L., McGruder, E.D., Whitford, H.W., Behle, R.W., Ray, P.M., Hargis, B. (1993). Genus-specific detection of salmonellae using the polymerase chain reaction (PCR). JVDI, 5,368-371. https://doi.org/10.1177/104063879300500311
Crim, S.M., Iwamoto, M., Huang, J.Y., Griffin, P.M., Gilliss, D., Cronquist, A.B., Cartter, M., Tobin-D’Angelo, M., Blythe, D., Smith, K. (2014). Incidence and trends of infection with pathogens transmitted commonly through food—Foodborne Diseases Active Surveillance Network, 10 US sites, 2006–2013. MMWR Morb Mortal Wkly Rep, 63, 328-32. PMID: 24739341
Feng, Y., Johnston, R.N., Liu, G-R., Liu, S-L. (2013). Genomic comparison between Salmonella Gallinarum and Pullorum: differential pseudogene formation under common host restriction. PLoS One, 8,e59427. https://doi.org/10.1371/journal.pone.0059427
Hirano T, Yamaguchi S, Oosawa K, Aizawa S-l (1994). Roles of FliK and FlhB in determination of flagellar hook length in Salmonella typhimurium. J Bacteriol, 176, 5439-5449. https://doi.org/10.1128/jb.176.17.5439-5449.1994
Holt, P.S., Chaubal, L.H. (1997). Detection of motility and putative synthesis of flagellar proteins in Salmonella Pullorum cultures. J Clin Microbiol, 35, 1016-1020. PMID: 9157122
Jones, T.F., Ingram, L.A., Cieslak, P.R., Vugia, D.J., Tobin-D’Angelo, M., Hurd, S., Medus, C., Cronquist, A., Angulo, F.J. (2008). Salmonellosis outcomes differ substantially by serotype. J Infect Dis, 198, 109-114. https://doi.org/10.1086/588823
Kang, M.S.K.Y., Jung, B.Y., Kim, A., Lee, K.M., An, B.K., Song, E.A., Kwon, J.H., Chung, G.S. (2011). Differential dentification of Salmonella enterica subsp. enterica serovar Gallinarum biovars Gallinarum and Pullorum based on polymorphic regions of glgC and speC genes. Vet Microbiol, 147, 181-5. https://doi.org/10.1016/j.vetmic.2010.05.039
Karns, J.S., Haley, B.J., Van Kessel, J.A.S. (2015). Improvements to a PCR-based serogrouping scheme for Salmonella enterica from dairy farm samples. J Food Prot, 78,1182-1185. https://doi.org/10.4315/0362-028X.JFP-14-475
Li, X., Payne, J., Santos, F., Levine, J., Anderson, K., Sheldon, B. (2007). Salmonella populations and prevalence in layer feces from commercial high-rise houses and characterization of the Salmonella isolates by serotyping, antibiotic resistance analysis, and pulsed field gel electrophoresis. Poultry Sci, 86, 591–597. https://doi.org/10.1093/ps/86.3.591
Majchrzak, M., Krzyzanowska, A., Kubiak, A.B., Wojtasik, A., Wolkowicz, T., Szych, J., Parniewski, P. (2014). TRS-based PCR as a potential tool for inter-serovar discrimination of Salmonella Enteritidis, S. Typhimurium, S. Infantis, S. Virchow, S. Hadar, S. Newport and S. Anatum. Mol Biol Rep, 41,7121-7132.  https://doi.org/10.1007/s11033-014-3592-9
Meshcheryakov, V.A., Barker, C.S., Kostyukova, A.S., Samatey, F.A. (2013). Function of FlhB, a membrane protein implicated in the bacterial flagellar type III secretion system. PLoS One, 8,e68384. https://doi.org/10.1371/journal.pone.0068384
Oliveira, S., Santos, L., Schuch, D., Silva, A., Salle, C., Canal, C. (2002). Detection and identification of salmonellas from poultry-related samples by PCR. Vet Microbiol, 87,25-35. https://doi.org/10.1016/S0378-1135(02)00028-7
Persson, S., Jacobsen, T., Olsen, J.E., Olsen, K., Hansen, F. (2012). A new real‐time PCR method for the identification of Salmonella Dublin. J Appl Microbiol, 113,615-621. https://doi.org/10.1111/j.1365-2672.2012.05378.x
Quinn, P.J., Markey, B.K., Leonard, F.C., Hartigan, P., Fanning, S., FitzPatrick, E. (2011). Veterinary Microbiology and Microbial Disease. John Wiley & Sons.
Rahn, K., De Grandis, S., Clarke, R., McEwen, S., Galan, J., Ginocchio, C., Curtiss, R., Gyles, C. (1992). Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol Cell Probes, 6, 271-279. https://doi.org/10.1016/0890-8508(92)90002-F
Ranieri, M.L., Shi, C., Switt, A.I.M., den Bakker, H.C., Wiedmann, M. (2013). Comparison of typing methods with a new procedure based on sequence characterization for Salmonella serovar prediction. J Clin Microbiol, 51,1786-1797. https://doi.org/10.1128/JCM.03201-12
Ribeiro, S.A.M., Paiva, J.B.d., Zotesso, F., Lemos, M.V.F., Berchieri Júnior, Â. (2009) Molecular differentiation between Salmonella enterica subsp enterica serovar Pullorum and Salmonella enterica subsp enterica serovar Gallinarum. Braz J Microbiol, 40,184-188. http://dx.doi.org/10.1590/S1517-83822009000100032
Rubio, M.d.S., Penha, Filho, R.A.C., Almeida, A.M.d., Berchieri, A. (2017). Development of a multiplex qPCR in real time for quantification and differential diagnosis of Salmonella Gallinarum and Salmonella Pullorum. Avian Pathol, 46,644-651.  https://doi.org/10.1080/03079457.2017.1339866
Salehi, T.Z., Mahzounieh, M., Saeedzadeh, A. (2005). Detection of invA gene in isolated Salmonella from broilers by PCR method. Int J Poult Sci, 4, 557-559
Swayne, D.E. (1998). laboratory manual for the isolation and identification of avian pathogens. American Association of Avian Pathologists, University of Pennsylvania, USA.
Uzzau, S., Brown, D.J., Wallis, T., Rubino, S., Leori, G., Bernard, S., Casadesús, J., Platt, D.J., Olsen, J.E. (2000). Host adapted serotypes of Salmonella enterica. Epidemiol Infect, 125, 229-255.
Whyte, P., Mc Gill, K., Collins, J., Gormley, E. (2002). The prevalence and PCR detection of Salmonella contamination in raw poultry. Vet Microbiol, 89, 53-60. https://doi.org/10.1016/S0378-1135(02)00160-8
Xiong, D., Song, L., Geng, S., Tao, J., An, S., Pan, Z., Jiao, X. (2016). One-step PCR detection of Salmonella Pullorum/Gallinarum using a novel target: the flagellar biosynthesis gene flhB. Front Microbiol, 7, https://doi.org/10.3389/fmicb.2016.01863
Xiong, D., Song, L., Tao, J., Zheng, H., Zhou, Z., Geng, S., Pan, Z., Jiao, X. (2017). An efficient multiplex PCR-based assay as a novel tool for accurate inter-serovar discrimination of Salmonella Enteritidis, S. Pullorum/Gallinarum and S. Dublin. Front Microbiol. 8. https://doi.org/10.3389/fmicb.2017.00420
Zhu, C., Yue, M., Rankin, S., Weill, F-X., Frey, J., Schifferli, D.M. (2015). One-step identification of five prominent chicken Salmonella serovars and biotypes. J Clin Microbiol, 53,3881-3883. https://doi.org/10.1128/JCM.01976-15