Detection and Phylogenetic Characterization of Virulence Genes of Escherichia coli Associated with Canine Urinary Tract Infections in India

Document Type: Genetics

Authors

1 1Department of Veterinary Medicine, College of Veterinary Sciences, the Lala Lajpat Rai University of Veterinary and Animal Sciences, Hisar, Haryana India 3Department of Veterinary Medicine, Faculty of Veterinary Medicine, University of Maiduguri, Borno State, Nigeria

2 Lajpat Rai University of Veterinary and Animal Sciences, Hisar, Haryana India

3 Department of Animal Biotechnology, College of Veterinary Sciences, the Lala Lajpat Rai University of Veterinary and Animal Sciences, Hisar, Haryana India

Abstract

BACKGROUND: Escherichia coli (E.coli) is one of the most common and important causative bacterium of urinary tract infections (UTIs) in both dogs and humans.
OBJECTIVES: This study aimed to identify virulence genes and a phylogenetic group of E. coli isolated from the urine of dogs suffering from UTIs.
METHODS: E. coli were isolated from urine of dogs suffering from UTIs and tested for the presence of the virulence genes using conventional polymerase chain reaction (PCR) and sequencing method.
On day 60 after immunization, half of the fish in each treatment was challenged intraperitoneally and the re- maining half of fish in the oral receiving bacterin groups were challenged by bath method with 1 LD50 and 1 LC50 of a Y. ruckeri local virulent isolate respectively.
RESULTS: Out of a total of 103 samples, 25 were found to be positive for E. coli, of these 20 (80.0%) were identified as aer, 14(56.0%) as pap, 12(48.0%) as sfa, 8(32.0%) as afa, 5(20.0%) as hly and 5(20.0%) as cnf1 genes. None of the isolates carried cnf2 genes.
CONCLUSIONS: The study demonstrated a high occurrence of virulence genes. The phylogenetic compar- isons of these gene sequences detected in uropathogenic E. coli isolated from dogs showed high similarity to those present in the urine of humans with urinary tract infection. Phylogenetic comparisons of the virulence genes revealed that hly, sfa , cnf1 and pap matched to group B2, afa to group A and aer to group B2 and D.

Keywords


Article Title [Persian]

شناسایی و مشخصات پلی ژنتیک حدت ژن های اشرشیا کلای موجود در مجاری ادراری سگ ها در هند

Authors [Persian]

  • محمد مصطفی 1
  • پروین گوئل 2
  • وینای کومار 3
  • سوشیلا مان 3
1 گروه دامپزشکی ،کالج علوم دامپزشکی ،دانشگاه لا لا لجپاتف،هیسار هاریانا، هند گروه دامپزشکی ، دانشکده دامپزشکی دانشگاه مایدوگوری ،بورنو، نیجریه
2 گروه دامپزشکی ،کالج علوم دامپزشکی ،دانشگاه لا لا لجپاتف،هیسار هاریانا، هند
3 گروه بیوتکنولوژی جانوران،کالج علوم دامپزشکی،دانشگاه دامپزشکی و علوم دامی لالالجپات رای ،هیسار هاریانا، هند

Introduction

Dogs are perhaps the most favoured do- mestic animal among all  the  pet  animals. In developed countries, companion animals have become an integral part of the house- hold (Chomel and Sun, 2011). Companion animals, especially dogs, suffer from vari- ous bacterial diseases affecting urinary tract leading to malfunctioning of this system, followed by critical medical emergency or death of the animal (Davison et al., 1999). Bacterial urinary tract infections (UTIs) are the most common cause of urinary tract disease in dogs. Approximately 14% of all dogs will acquire bacterial UTIs during their lifetimes with variable age of onset (Os- borne, 1999).

Escherichia coli (E. coli) is the most prevalent and important causative agent of UTIs in dogs and humans, strains of this spe- cies are often abundant in the gastrointes- tinal tract at the time of infection (John- son et al., 2003; Momoh et  al.,  2011; Tramuta et al., 2011 Saraylu et al.,  2012).

However, E. coli that are associated with UTIs are commonly named uropathogenic isolates (UPEC), although there is evidence that different pathotypes may be related to UTIs (Marrs et al., 2005). Urinary tract in- fections are mostly common in dogs, but clinical signs are often minimal, and the infection may go undetected (Ling, 1995). Uropathogenic Escherichia coli is one of the most common bacteria isolated from canine and feline UTIs (Osugui et al., 2014).

Uropathogenic   Escherichia    coli    con- tain  several  virulence  factors  that  facili-  tate its colonization and  invasion  of  host  cells (Ejrnæs, 2011; Kudinha etal, 2012; Agar- wal et al., 2013). Surface virulence factors (ad- hesins) of UPEC are among the most im- portant  virulence  factors (Ni -


 

cole, 2008; Bien et al., 2012).The main attachment factor, P fimbriae are particularly associated with pyelonephritis and are en- coded by pap genes (Jadhav et al., 2011). Another adhesion that acts as a virulence factor is S fimbrial adhesion, which  is cod- ed by sfa  genes  (Bien et al., 2012; Pobie-  ga et al., 2013). Also, afimbrial adhesions (afa) of E. coli, coded by afa genes, have been  reported  in  cases   of   pyelonephri-  tis (Servin, 2005). Other important  viru- lence factors of UPEC strains are the tox-  ins that act as secretory virulence factors (Bien et al., 2012). The most important secre- tory virulence factor is A-hemolysin (hlyA), which is encoded by the hly gene. Also, cy- totoxic necrotizing factor 1 (cnf1) is reported in a third of pyelonephrogenic strains (John- son, 1991). Other virulence factors also have important roles in the development of UTIs, including serum resistance ability due to the outer membrane protein traT encoded by  traT genes (Mellata et al., 2003; Kawamu- ra-Sato et al., 2010). Aerobactin is a bacterial siderophore encoded by aer genes and has re- cently been documented as a viru- lence factor in UPEC strains (Slaychev et al., 2009). The virulence  factors are  car- ried by pathogenicity islands  (PAIs),  which are mobile  genetic  elements that con- tribute to the horizontal transfer of viru- lence determinants (Hacker et al., 1997; Sa- bate et al., 2006). Phylogenetic analyses showed that E. coli strains and virulence genes were divided into four major phy- logenetic groups (A, BI, B2, and D) based  on  their  genetic  polymorphisms   (Cler- mont et al., 2000). It is known that the ex- pression of virulence genes and phylotypes varies with geographical  location  (Agarw- al et al., 2013). However, phylogenetic  char-

 

 

 

acterization is an important tool to improve the understanding of E. coli populations and their relationship between strains and dis- ease (Coura et al., 2015). Molecular charac- terization of E. coli virulence genes that are associated with UTIs in dogs has been stud- ied in America and most parts of the world. However, in India, there is relatively less documented information on E. coli virulence genes associated with UTIs in dogs. The cur- rent study aimed to determine the virulence genes and their phylogenetic grouping in E. coli  isolates  from  dogs  with  UTIs.

Materials and Methods

Sample Collection

From February  2017  to  January  2018, a total of 103 urine samples were collect-  ed aseptically through cystocentesis from dogs that were diagnosed with urinary tract infection in small animal section of Veteri- nary Clinical Complex (VCC), Lala Lajpat Rai University of Veterinary and Animal Sciences (LUVAS) Hisar Haryana,  India.

Bacteriological Examination

The fresh urine samples collected asep- tically were inoculated and streaked onto a 5% sheep blood agar (BA) (HiMedia, Mum- bai, India) and MacConkey’s lactose agar (MLA) (HiMedia, Mumbai, India) plates separately with the help of a 4 mm diame- ter platinum loop. The plates were incubat- ed aerobically at 37°C for 24-48h till ad- equate growth was observed. Suspect- ed colonies were streaked onto Eo- sine Methylene Blue agar (EMB), (HiMe- dia, Mumbai, India) which is a selective medium for E. coli and the plates were incubated aerobically at 37°C for 24h. The appearance of blue, green colonies with a metallic luster on EMB was presumptive-  ly considered as indicating the presence   of


Escherichia coli.

Biochemical Examination

Escherichia coli was identified using Gram staining technique. Samples with rod-shaped arrangements  were  subjected  to biochemical tests. (Indole, Methyl Red, Voges Proskauer, Citrates tests, Glucuro- nidase, Nitrate reduction, ONPG, Lysine utilization, Lactose, Glucose, Sucrose and Sorbitol) using commercially KB010 HiE. coliTM Identification Kit (HiMedia Mum- bai, India) following the manufacturer’s in- structions.

Isolation of Bacterial DNA

DNA of Escherichia coli from all the positive isolates was extracted using com- mercial available PureLinkTM Genom- ic DNA mini kit (Invitrogen, USA) fol- lowing the manufacturer’s instructions as shown below.

DNA of Escherichia coli from all the positive isolates was extracted using com- mercial available  PureLinkTM  Genomic DNA mini-kit (Invitrogen,  USA).  Brief-  ly, overnight grown culture in BHI  broth (10 ml) was centrifuged at 10000 rpm for  10 min at 4°C. Supernatant was discarded and pellet was re-suspended in 200μl of di- gestion buffer. Then 20μl of proteinase K was added and vortexed vigorously. The solution was then transferred into 2ml mi- cro centrifuge tube and incubated in water bath (Bench Top Lab System, USA) for 2 h at 55°C. A total 200μl of both lysis/binding buffer and absolute ethanol was then added and each tube was carefully vortexed in or- der to mix the contents of the tube evenly. The solution was then carefully transferred into a PureLinkTM column and then centri- fuged. Five hundred microliters (500μl) of buffer I was added to the samples, mixed and  centrifuged  for  2  min  at  12000 rpm,

 

 

 

the wash trough was discarded. Then 500μl of buffer II was added and the column was centrifuged for 2 min at 12000 rpm, the wash trough was discarded and the empty column was centrifuged for 2 min. The col- umn was then transferred into a fresh 1.5ml micro centrifuge tube. Finally, for eluting the DNA, 30μl of elution buffer was add-  ed at the centre of the column, the column was incubated for 10 min at room tempera- ture and then centrifuged at 12000  rpm for 2 min. The flow through was collected in    a 1.5ml micro centrifuge tube as the DNA. The obtained DNA was stored at -20 °C for further use.

Detection of Virulence Genes

The presence of virulence genes in  E. coli DNA extracts was determined by con- ventional PCR (Manage et al., 2019). Prim- ers sequences, target genes, products size, and references are given in Table 1. The conventional PCR was performed in veriti thermo cycler (ABI, USA) in 25 volume re- action containing 6 µl of template DNA, 1µl of each of the primers (10 pmoles), 12.5 µl Phusion PCR Master-mix (2X) (High Fi- delity, USA), 1µl DMSO and 3.5 µl of nu- clease-free water. Amplification procedure consisted of initial denaturation at 98 °C for 30 s, followed by 35 cycles of denaturation at 98 °C for 10 s, annealing at 60 °C for     30 s, extension at 72°C for 30 s and a final extension at 72°C for 5 min. The PCR prod- ucts were analyzed on 1.5% agarose gel electrophoresis and visualized under UV trans-illuminator GEL-DOC™ (BIO-RAD, India) and documented by photography for further analyses.

Nucleotide sequence analysis of the virulence genes and their phylogenetic comparisons

The   PCR   products   obtained   were    pu-


rified using PureLinkTM Quick Gel  Ex- traction   Kit   (Invitrogen,   Germany)   and  the cycle sequencing reactions were per- formed in a total volume of 10µl us-  ing Big Dye Terminator v 3.1 Cycle Sequenc- ing Kit (ABI, USA) in automated DNA se- quencer (Applied Biosystem 3130XL Genetic Analyzer). The DNA sequencing was per- formed in both directions with the PCR prim- ers as sequencing primers (Table 1).

The resulting sequences obtained from  the sequencer were used to make Contigs using SeqMan program in Lasergene suite (version 5). The contigs were then com- pared with those reported in GenBank (NCBI) by a BLAST search online. Clustal W (Bioedit software ver 9.0) was used for multiple sequence alignment, and Mega 6.0 bioinformatics sequence analysis tool was used for phylogenetic studies.

Statistical analysis

Vassarstat was used for the analysis of confidence  interval (proportion).

Results

Examination of a total of 103 urine sam- ples from dogs suffering from UTIs for detec- tion of Escherichia coli revealed 25 (24.3%) positive isolates.

The cultural growth on MacConkey lactose agar was seen as typical purple/pink colonies. However, the positive isolates were further confirmed as E. coli by inoculation on Eo- sine-Methylene blue agar  medium.

Microscopic examination of gram stained colonies shows a gram negative rod-shaped arrangement. The biochemical test showed that E. coli were positive for Indole, Methyl red, Glucuronidase, Nitrate, ONPG, Lysine utilization, Lactose, Glucose, Sucrose, and Sorbitol. On the other hand, all the strains were  negative  for Voges-Proskauer’s  and Ci-

 

 

Table 1. Primers for conventional PCR assays

 

Target

 

Genes

 

Primers   Sequences

Product Size (bp)

 

References

 

cnf1

F: AAGATGGAGTTTCCTATGCAGGAG R: CATTCAGAGTCCTGCCCTCATTATT

 

498

 

(Falbo et   al.,1992)

 

cnf2

F:GTGAGGCTCAACGAGATTATGCACTG R:CCACGCTTCTTCTTCAGTTGTTCCTC

 

839

 

(Pass et   al.,2000)

 

Pap

F: GCAACAGCAACGCTGGTTGCATCAT R: AGAGAGAGCCACTCTTATACGGACA

 

336

 

(Yamamoto et   al., 1995)

 

Aer

F: TACCGGATTGTCATATGCAGACCGT   R: AATATCTTCCTCCAGTCCGGAGAAG

 

602

 

(Herrero et   al., 1988)

 

Afa

F: GCTGGGCAGCAAACTGATAACTCTC   R: CATCAAGCTGTTTGTTCGTCCGCCG

 

750

 

(Le   Bouguenec  et al., 1992)

 

sfa

F: CTCCGGAGAACTGGGTGCATCTTAC   R: CGGAGGAGTAATTACAAACCTGGCA

 

410

 

(Le   Bouguenec  et al., 1992)

 

hly

F: AACAAGGATAAGCACTGTTCTGGCT R: ACCATATAAGCGGTCATTCCCGTCA

 

1177

 

(Nam et al.,   2013)

 trate utilization test.

Of the 25 E. coli isolates assayed, 20(80.0%) showed the presence of aer, while 14 (56.0%), 12(48.0%),   8(32.0%)   and  5(20.0%)    were

found to have pap, sfa, afa, cnfI and hly genes respectively. No cnf2 gene was found in any  of the E. coli isolates tested (Table 2).

The aer, afa, cnf1, hly, sfa, and pap gene se-

quences show the highest nucleotide   similar-


ity of 99% with several strains retrieved from the GenBank data base.

hly, sfa, cnf1, and pap gene sequence were highly similar to the sequences that were associated with the phylogenetic group B2 whereas aer gene sequences showed maxi- mum similarity to the one in B2 and D phy- logenetic group and afa sequence grouped within the phylogenetic group A.

 

 

Table 2. Distribution of virulence genes of E. coli isolated from 25 dogs diagnosed with UTIs in Hisar Haryana, India.

 

Virulent   genes

(%) No. of   isolates

Proportion

95% CI (Lower   Limit)

95% CI (Upper   Limit)

CnfI

5

0.0485

0.0209

0.1086

cnf2

0

0.0

0.0

0.0

Pap

14

0.1359

0.0827

0.2153

Aer

20

0.1942

0.1294

0.281

Afa

8

0.0777

0.0399

0.1459

Sfa

12

0.1165

0.0679

0.1927

Hly

5

0.0485

0.0209

0.1086

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

                        Figure 1. Agarose gel electrophoresis of  aer and  pap

 

   

Figure 2. Agarose gel electrophoresis of  sfa and  afa

 

   

Figure 3. Agarose gel electrophoresis of  cnf1 and  hly

 

 

 

 

 

Figure 4. Agarose gel electrophoresis of  cnf2

 

Discussion

Distribution of virulence factor gene as- sociated with canine UTIs has not been pre- viously determined and characterized in the study area (Hisar, India). The  presence  of the most common virulence genes such as aer, pap, sfa, afa, and hly detected in E. coli strains isolated in the present study estab- lished the pathogenic potentials of E. coli in dog’s  urogenital infections.

Aerobactic receptor gene, coded by aer, promotes bacterial growth in the limiting iron concentration encountered during in- fection and act as a virulence factor in the pathogenesis of UTIs (Mittals et al., 2014). However, iron is necessary for E. coli metab- olism (Siqueira et al., 2009). Growth under iron-restricted conditions requires bacterial mechanisms that successfully compete with the host for the ion (Emody et al., 2003). Escherichia coli organism uses ion for ox- ygen transport and storage, DNA synthesis, electron transport, and peroxide metabolism (Siqueira et al., 2009). The aer virulent gene may be relevant during bacterial spreading from the urinary tract to the bloodstream (Garcia and Le Bouguenec, 1996). The aer virulent gene was seen in 80.0% of the iso- lates in the present study, this is because   aer


 

is a virulence factor in UPEC strains. Simi- larly, Slaychev et al. (2009) found compara- ble gene in their study as a virulent factor. In other studies, the detection of aer has been reported to be more than 30.0% and 56.0% (Firoozeh et al., 2014; Munkhdelger et al., 2017), which is in concordance with the current study. Furthermore, Drazenovich  et al. (2004) also found aer in 30.0% from E. coli strains isolated with persistent UTIs in dogs. The present study demonstrated high occurrence of aer genes in uropathogenic E. coli strains suggesting that the frequencies of iron acquisition system genes vary according to the geographical locations.

In the current study, most of the uropatho- genic E. coli was isolated from the urinary tract of dogs. This finding agrees with the findings of Siqueira et al. (2009), in which they documented that adhesion and coloni- zation of the uroepithelium is the most im- portant phenomenon involving uropathogen- ic E. coli. However, these adhesions promote bacterial adherence and are indispensable for the infection to be established as was report- ed by (Johnson, 1991; Emody et al., 2003; Marrs et al., 2005). P fimbria, encoded by pap, could probably contribute to the ad- hesion and colonization of the urinary tract because this virulence gene is always associ-

 

 

 

ated with pyelonephritis (Usein et al., 2001; Chen et al., 2003; Jacobsen et al.,  2008).

In the present study, pap was found in 56.0% E. coli strains isolated from canine urinary tract infections cases indicating that  E .coli isolates from the urine of dogs and cats have greater ability to colonize kidney and generate pyelonephritis (Antao et al., 2009). Shetty et al. (2014) reported that 60.87% of the uropathogenic strains of E. coli obtained from humans showed pap genes. Siquieira et al. (2009) found 23.5% papC positive strains among the E. coli strains isolated from dogs suffering from UTIs. Whereas Tramuta et al. (2014) identified pap in 13.4% E. coli iso- lates obtained from dog urine.

The S fimbriae adhesion (sfa) was found in 48.0% of the isolates obtained from UTIs in- fected dogs. This result is consistent with the occurrence of sfa (45.2%) in clinical isolates of human origin (Rahman and Deka, 2014). Similar findings were recorded in previous studies in dogs (Coogan et al., 2004; Sique- ira et al., 2009). In recent studies involving dogs (Tramuta et al., 2014) and human (Adib et al., 2014), sfa genes were found in more than 20.0% of UTI isolates studied. The demonstration of sfa gene in dog’s urine was observed in 52.0% of the isolates in anoth-  er study (Drazenovich et al., 2004). Like- wise, more than 12.0% of the E. coli strains from cats show sfa genes. Further, Shetty et al. (2014) also observed the presence of sfa gene in 39.1% isolates obtained from human UTIs. Therefore, these findings highlight that sfa gene plays a vital role in both adhesions to the urogenital epithelium and the develop- ment of urinary tract infection in companion animal, especially dogs.

Afimbrial adhesion (afa) gene was found to be implicated in developing nephritis in human (Mulvey, 2002). In the current  study,


afa gene was found in high frequency in  the

E. coli isolates (32.0%) as compared with strains from another study in dogs with UTIs (6.0%) (Drazenovich et al., 2004), but found lower in frequency in E. coli isolates report- ed from humans, 39.1% and 64.0% (Yama- moto et al., 1995; Shetty et al., 2014). On the other hand, Ebadi et al. (2017) reported that 9.3% of the E .coli strains identified from hu- man clinical samples showed fimbrial genes (afa BC). However, Dr adhesion family rec- ognize human receptors on erythrocytes and other tissues (Mulvey, 2002), and this may explain the low incidence of this ‘A’ fimbrial adhesion factor observed in canine isolates as previously reported (Siqueira et al., 2009). Uropathogenic E. coli strains  isolated from a dog with UTI express  the presence of cytotoxic necrotizing factor 1 (cnf1) and Alpha-haemolysin gene (hly). The hly gene is a pore-forming toxin that lyses not only erythrocytes of all mammals and even that of fishes (Johnson, 1991) but also leukocytes, endothelial and renal  epithelial cells (Usein et al., 2001; Emody et al., 2003). Alpha-hae- molysin gene (hly) was found present in 20.0% of the UTI isolates of the current study, similarly, Tramuta et al. (2014), Rah- man and Deka (2014), Liu et al. (2017) and Rashki et al. (2017) also recorded 18.0%, 36.8%, 39.0% and 10.0% of hly gene in UTIs isolates in dogs and humans respec- tively. In another study, Drazenovich et al. (2004) demonstrated that the hly gene was found in 50.0% of the E. coli isolates recov- ered from the urine of dogs. Siqueira et al. (2009) also found that 33.3% of the    canine

isolates contained hly genes.

Cytotoxic necrotizing factor 1 (cnf1) is a toxin that can cause reorganization of actin microfilament in eukaryotic cells. The cy- totoxin  may facilitate  the bacterial  invasion

 

 

 

of the bloodstream as a result of  interfer- ence with polymorpho-nuclear phagocyto- sis and even evokes apoptotic death of epi- thelial cells in the bladder (Oelschlaeger et al., 2002; Emody et al., 2003). In the pres- ent study, cnf1 was found in 20.0% of the UTIs strains. This was less than what was reported by Rahman and Deka (2014) who found 61.9% of the isolates from humans UTIs produce cnf1 genes. Drazonavich et al. (2004) reported cnf1 genes in 50. 0% of   the

E. coli isolates from dogs.

Furthermore, Johnson et al. (2003) report- ed that 41.0% of E. coli isolates obtained from canine UTIs produce cnf1. Liu et al. (2017) found 46.6% of the isolates contained cnf1. However, the results of the current study show less occurrence of cnf1 in the E. coli isolates. This could probably be attribut- ed to the mutation of this gene or could be due to variation in the geographical distribu- tion of these genes.

In the present study, none of these E. coli isolates harbored the gene that encodes cy- totoxic necrotizing factor 2 (cnf2), which is also related to UTIs. In contrast,  Rahman and Deka (2014) found cnf2 in E. coli iso- lates obtained from humans suffering from UTIs. These results indicate that cnf2 may probably be of less significant in the uro- pathogenic E. coli pathogenesis in  canine.

The phylogenetic analysis revealed that afa, aer, sfa, cnf1, hly, and pap genes exhib- ited 99% identity with the different variants in several geographical regions of the world. The E. coli falls into four leading phylogenet- ic groups: A, B1, B2, and D (Clermont et al., (2000). In the present study, the phylogenet- ic comparisons of virulence gene sequenc-  es show that sfa, cnf1, hly and pap genes matched group B2 and, these results are con- sistent with the findings noted by other inves-


tigators (Tramuta et al., 2011; Munkhdelger et al., 2017; Coura et al., 2018).  However, aer virulence gene was found to match both B2 and D phylogenetic group. This is consis- tent with the previous study that demonstrat- ed that aer sequence belongs to B2 and D phylogenetic group (ZhuGe et al., 2014; Liu et al., 2015). Moreover, only afa virulence gene sequence was found to fall within phy- logenetic group A. This is also in accordance to recent studies, where it has been shown that afa gene sequence was observed to be associated to phylogenetic group A (Marti et al., 2017; Munkhdelger et al.,  2017).

In the current study, majority of the viru- lence gene sequences were found to be as- sociated with the phylogenetic group B2, suggesting that these strains were more vir- ulent than others. Similar outcomes were observed in a recent study conducted by Pi- atti et al. (2008) who found an association between virulence factors and phylogenetic group in urinary E. coli strains isolated in hu- mans. Furthermore, most of the extraintes- tinal pathogenic E. coli (ExPEC), including those with the most robust virulence factors repertories and those  which  are  best  able  to infect non-compromised hosts, are de- rived from phylogenetic group B2 (Johnson, 2002). Group D contains the second-highest number of ExPEC, extraintestinal isolates. This group typically have somewhat fewer virulence factors and a different mix of viru- lence factors than group B2 isolates. E. coli strains belonging to group A and B1 do not frequently cause extraintestinal infection. These strains that are not highly virulent cause disease only in immunocompromised hosts, and could be pathogenic in healthy hosts only if they were to acquire sufficient extraintestinal virulence factors (Johnson, 2002).

 

 

 

In conclusion, the results of the present study demonstrated a high occurrence of vir- ulence genes. The phylogenetic comparisons of these gene sequences detected in UPEC isolated from dogs  showed  high  similarity to those present in the urine of humans with urinary tract infection. Therefore, the pres- ent study supports the assertion that dogs may serve as a reservoir for human infection with pathogenic E. coli. The phylogenetic comparison showed that hly, sfa, cnf1, and pap virulence genes matched to group B2, afa to A and aer to group B2 and D, indicat- ing B2 as the dominant phylogenetic group among UPEC strains in Hisar, Haryana and virulence-associated genes were mostly dis- tributed in this group. Further studies are re- quired on virulence genes and their specific phylogenetic background with a large num- ber of samples to advance our understanding of uropathogenic E. coli in companion an- imals especially dogs, and this may help in controlling urinary tract infection in  future.

Acknowledgments

This work was financed by the Indian Council for Cultural Relations (Ministry of External Affairs, Government of India) and Department Veterinary Medicine, LUVAS, Hisar, Haryana.

Conflict of Interest

The authors declare that there is no con- flict of interest.

Adib, N., Ghsnbarpour, R., Solatzadeh, H., Al- izade, H. (2014). Antibiotic resistance profile and virulence genes of uropathogenic Escherichia coli isolates in relation to phylogeny. Trop. Biomed, 31:

17-25. PMID: 24862040

Agarwal, J., Mishra, B., Srivastava, S., Srivas- tava,  R. (2013).Genotypic  characteristics  and bio-


films      formation among Escherichia coli isolates

from Indian women with acute cystitis. Royl. So- cieties Tropical. Med. Hyg, 107: 165-169. https:// doi.org/10.1093/trstmh/trs090. PMID: 23296752.

Antao,  E.M.,  Wieler,  L.H.,  Ewers,  C.  (2009).

Adhesive threads of extraintestinal pathogenic Escherichia coli. Gut pathol, 1: 22. https://doi. org/10.1186/1757-4749-1-22. PMID: 20003270.

Bien, J., Sokolova, O., Bozko, P.  (2012).   Role

of uropathogenic Escherichia coli virulence fac- tors in development of urinary tract infection and kidney  damage.  Intern.  J. Nephrol,  1– 15. Article

Chen, Y.M., Wright, P.J, Lee, C., Browning, G.F.

(2003). Uropathogenic virulence factors in isolated of Escherichia coli from clinical cases of canine pyometra  and  feces  of  healthy  bitches.  Vet. Mi-

Chomel,   B.B.,   Sun,   B.   (2011).   Zoonoses

in the bedroom. Emerg. Infect. Dis, 17: 167- 172.https://doi.org/10.3201/eid1702.101070. PMID:  21291584.

Clermont, O., Bonacorsi, S., Bingen, E. (2000).

Rapid and simple determination of the Escherichia coli        phylogenetic   group.  Appl   Environ.  Mi-

Coogan,   J.A.,   Oliveira,   C.M.,   Faustino,  M.,

Moreno, A.M., Vonsydow, A.C.M.D.G., Melville, P.A., Benites, N.R. (2004). Estudo microbiológico de conteúdo intrauterine de cadelas com pyome-  tra epesquisa de fatores de virulência em cepas de Escherichia coli. Arquivos do Instituto Biológi- co,71: 513–51.

Coura,  F.M.,  Diniz,  S.A.,  Silva,  M.X,   Mussi,

J.M.S.,   Barbosa,   S.M.,   Lage,  A.P., Heinemann,

M.B.    (2015). Phylogenetic group determination of Escherichia coli Isolated from Animals Samples. The scientific world, 1 4, Available from: <https:// www. hindawi.com/journals/tswj/2015/2584 24.

Coura, F.M., Diniz, A.N., Junior, C.A.O.,  Lage,

A.P., Lobato, F.C.F., Heinemann, M.B., Silva, R.O.S. (2018). Detection of virulence genes and the phy- logenetic groups of Escherichia coli isolated from dogs in Brazil Ciencia Rural, Santa Maria, 48: 1-6.

 

 

 

Davison, A.M., Cumming, A.D., Swainson, C.P., Turner, N. (1999). Disease of the kidney and urinary system. in Davidson’s: Principles and Practice of Medicine.18th edn. Haslett C, Chilvers ER, Hunter JAA, Boon NA. (eds) Edinburgh: Churchill Living- stone (UK), 417- 470.

Drazenovich, N., Ling, G., Foley, J. (2004). Mo- lecular investigation of Escherichia coli strains associated with apparently persistent urinary tract infection in dogs. J Vet.  Intern Med, 18:301-   306.

PMID: 15188815.

Ebadi, M., Askari, N., Jajarmi, M., Ghanbarpour,

R. (2017). Detection of Fimbrial Genes, Antibiotic Resistance Profile and Phylogenetic Background of Uropathogenic E. coli Isolated from Clinical Sam- ples in Karaj City, Iran J Med. Bacteriol, 6:15-20.

Ejrnæs, K. (2011). Bacterial characteristics of importance for recurrent urinary tract infections caused by Escherichia coli. Dan Med Buletin, 58:1–

22. PMID: 21466767.

Emödy, L., Kerényi, M., Nagy, G. (2003). Vir- ulence  factors  of  uropathogenic  Escherichia coli.

Intern. J Antimicrob Agents, 22:29–33. https:// doi.org/10.1016/s0924-8579(03)00236-x. PMID: 14527768.

Falbo, V.,  Famiglietti, M., Caprioli, A.  (1992).

Gene block encoding production of cytotoxic nec- rotizing factor 1 and hemolysin in Escherichia coli isolates from extraintestinal infections. Infect    Im-

mun, 60:2182-7. PMID: 1587586.

Firoozeh, F., Saffari, M., Neamati, F., Zibaei, M. (2014). Detection of virulence genes in Escherichia coli isolated from patients with cystitis and pyelone-

phritis. Intern J Infect Dis, 29: 219–222. https://doi. org/10.1016/j.ijid.2014.03.1393. PMID: 25449257.

Garcia,  M. I., Le Bouguénec,  C. (1996).    Role

of adhesion in pathogenicity of human uropatho- genic  and  diarrhoeogenic  Escherichia  coli.  Bul-

letin of Institute Pasteur, 94:201–236. https://doi. org/10.1016/S0020-2452(97)86017-4.

Hacker,   J.,  Blum-Oehler,   G.,  Muhldorfer,   I.,

Tschape. (1997). Pathogenicity islands of virulent bacteria: structure, function and impact on microbi-

al evolution. Mole Microbiol, 23:1089–97. https:// doi.org/10.1046/j.1365-2958.1997.3101672.x PMID: 9106201.

Herrero,  M.,  de  Lorenzo,  V.,   Neilands,  J.B.


(1988). Nucleotide sequence of the iucD gene  of the  pColVK30  aerobactin  operon  and  to-  pology of its product studied with phoA and    lacZ

gene fusions .J Bacteriol, 170:85-64. https://doi. org/10.1128/jb.170.1.56-64.1988. PMID: 3275632.

Jacobsen,  S.M.,  Stickler,  D.J.,  Mobley,    H.L.,

Shirtliff, M.E. (2008). Complicated catheter-associ- ated urinary tract infections due to Escherichia coli and Proteus mirabilis.  Clin Microbiol Rese, 21:

Jadhav,  S., Hussain, A., Devi,  S., Kumar,   A.,

Parveen, S., Gandham, N. (2011).Virulence charac- teristics and genetic affinities of multiple drug re- sistant uropathogenic Escherichia coli from a semi urban    locality   in   India.   Plos   One,  6:e18063.

Johnson,  J.R.,  Kaster,  N.,  Kuskowski,  M.A.,

Ling, G.V. (2003). Identification of urovirulence traits in Escherichia coli by comparison of uri-  nary and rectal E. coli isolates from dogs with urinary tract infection. J   Clin Microbiol,   41:337-

Johnson, J.R. (1991).Virulence factors in Esch- erichia coli urinary tract infection. Clin  Micro-  biol   Rev,   4:   80–128.   doi:   10.1128/cmr.4.1.80.

PMID: 1672263.

Johnson, J.R. (2002). Evolution of pathogenic Escherichia coli. In: Donnenberg M (ed.). Esch- erichia coli: Virulece Mechanism of a Versatile Pathogen. 1st ed. pp. 55-77, Academic Press, San Diego.

Kawamura-Sato, K.Yoshida, R., Shibayama, K., Ohta, M. (2010).Virulence genes, quinolone and fluoroquinolone resistance, and phylogenic back- ground of uropathogenic Escherichia coli strains                        isolated  in  Japan.  Japan  J Infect

Dis, 63:113–5. PMID: 20332573.

Kudinha, T., Kong, F., Johnson, J., Andrew, S., Anderson, P., Gilbert. G. (2012). Multiplex PCR based reverse line blot assay for simultaneous detection of 22 virulence genes in uropathogenic Escherichia coli. Appl Environ Microbiol, 78:1198–

  1. https://doi.org/10.1128/AEM.06921-11. PMID: 22156422.
Le Bouguenec, C., Archambaud. M.,  Labigne,

 

 

 

  1. (1992). Rapid and specific detection of the  pap,  afa, sfa adhesion encoding operons in uro- pathogenic Escherichia coli strains by polymerase chain     reaction.   J  Clin   Microbiol,  30:1189-93.
PMID: 1349900.

Ling, G. (1995). Lower Urinary Tract Diseases of Dogs and Cats. St Louis, MO: Mosby.

Liu,  C., Zheng,  H., Yang,  M., Xu, Z.,   Wang,

X., Wei, L., Tang, B., Liu, F., Zhang, Y.,  Ding,   Y.,

Tang,    X.,Wu, B,T.J., Johnson, T.J., Chen, H., Tan,

C. (2015). Genome analysis and in vivo virulence of  porcine  extraintestinal  pathogenic  Esche- richia coli strain PCN033. BMC Gen, 16:118.  doi:

10.118 6/s12864-015-1890-9. PMID: 26391348. Liu, X., Liu, H., Li, Y.,  Hao, C. (2017).  Asso-

ciation between virulence profile and fluoroquino- lone resistance in Escherichia coli isolated from dogs  and  cats  in  China.  J  Infect  Devel   Contri,

11:306- 313.https://doi.org/10.3855/jidc.8583. PMID: 28459221.

Manage, D. P., Lauzon, J., Jones, C. M., Ward, P.

J., Pilarski, L. M., Pilarski, P. M., McMullen, L. M. (2019). Detection of pathogenic Escherichia coli on potentially contaminated beef carcasses using cas- sette PCR and conventional PCR. BMC microbiol-

Marrs, C.F., Zhang, L., Foxman, B. (2005). Esch- erichia coli mediatedurinary tract infections: Are there distinct uropathogenic E. coli (UPEC) pathotypes? FEMS Microbiol Lett, 252:183- 190.

Marti, R., Schmid, M., Kulli, S.,   Schneeberger,

K., Naskova, J., Knøchel, S., Ahrens, C.H., Hummerjohanna, J. (2017). Biofilm formation po- tential of heat resistant Escherichia coli dairy isolates and the complete genome of multidrug re- sistant, heat resistant strain FAM21845. Appl

Environ Microbiol, 83: 15, 1-20. E00628- 17.https://doi.org/10.1128/AEM.00628-17. PMID: 28550056.

Mellata,  M.,  Dho-Mouli,  M.,  Dozois,  C.M.,

Curtiss, R.,  Brown,  P.K.,  Arne,  P.  (2003).  Role of virulence factors in resistance of avian patho- genic Escherichia coli to serum and in pathog    In-

fec Immunol,71:536–40.https://doi.org/10.1128/ iai.71.1.536-540.2003. PMID: 12496207.


Mittals, S., Sharma, M., Chaudhary, U. (2014). Study of virulence factors of uropathogenic Escherichia coli and  its  antibiotics  susceptibili-  ty  pattern.  Indian  J  Pathol  Microbiol,  57:61-64.

Momoh,  A.R.M.,   Orhue,   P.O.,   Idonije, O.B.,

Oaikhena, A.G., Nwoke, E.O. (2011). The anti- biogram types of Escherichia coli isolated from suspected urinary tract infection samples. J Micro- biol Biotech  Res, 1:57-65.

Mulvey, M.A. (2002). Adhesion and entry of uropathogenic Escherichia coli. Cell Microbiol 4: 257–271.

Munkhdelger, Y., Gunregjav, N., Dorjpurev, A., Juniichiro, N., Sarantuya, J. (2017). Detection of virulence genes, phylogenetic group and antibiotic resistance of uropathogenic Escherichia coli

in Mongolia. Infect Dev Ctries, 11:51-57. https:// doi.org/10.3855/jidc.7903. PMID: 28141590.

Nam,  E.H.,  Sungjin,  K., Joon  Seok,  C., Cheol

Yong, H. (2013). Characterization and zoonotic potentials of uropathogenic E.coli isolates from dogs. J. Micrcobiol. Biotech, 23:422-429.

doi:10.4014/jmb.1209.09051. PMID:  23462017.

Nicolle, L.E. (2008). Uncomplicated urinary  tract infection in adults including uncom plicated pyelonephritis.  Urol  Clin  North  Am,   35:1–12.

Oelschlaeger,    T.A.,    Dobrindt,    U.,    Hack- er,    J.    (2002).Virulence    factors    of   uropatho-

gens. Curr Opin Urolog, 12: 33–38. https://doi. org/10.1097/00042307-200201000-00007. PMID: 11753131.

Osborne, C.A. (1999). Three Steps to  Effective

Management of Bacterial Urinary Tract Infections: Diagnosis, Diagnosis, Diag. Compend, 17:1233- 1240.

Osugui, L., de Castro, A.F., Iovine, R., Irino, K., Carvalho, V.M. (2014). Virulence genotypes, antibi- otic resistance and the phylogenetic background of extraintestinal pathogenic Escherichia coli isolated from urinary tract infections of dogs and cats in Bra-

zil. Vet Microbiol, 171:242 247. PMID: 24742952. Pass, M.A., Odedra, R., Batt, R.M. (2000). Multiplex PCRs for identification of Escherichia coli   virulence genes. J Clin Microbiol, 38:2001-4.

 

 

 

PMID: 10790141.

Piatti,  G.,  Mannini,  A.,  Balistreri,  M., Schito,

A.M. (2008) .Virulence factors in urinary Esche- richia coli strains: phylogenetic background and quinolone  and  fluoroquinolone  resistance.  J Clin

Microbiol, 46:480-487. https://doi.org/10.1128/ JCM.01488-07. PMID: 18057134.

Pobiega,   M.,   Wojkowska-Mach, J.,   Ch-

mielarczyk, A., Romaniszyn, D., Adamski, P., Hec- zko,    P.B.   (2013).  Molecular  characterization and drug resistance of Escherichia coli strains iso- lated from urine from long-term care facility res- idents in Cracow, Poland. Med Sci Monit, 19:317–

26.  https://doi.org/10.12659/MSM.883898. PMID:

Rahman, H., Deka, M. (2014). Detection and characterization of necrotoxin producing Esche- richia coli    (NTEC) from patients with urinary tract infection (UTI). Indian J Med Res,    139:632-

637. PMID: 24927352.

Rashki, A., Abdi, H.A., Shookohi, M. (2017). Prevalence of Genes Encoding Outer Membrane- Virulence                        Factors  among Fecal Escherichia coli Isolates Intern J Basc Sci Med, 2:52-57.

Sabate,  M.,  Moreno,  E.,  Perez,  T.,  Andreu, A., Prats, G. (2006). Pathogenicity  island  mark- ers in commensal  and  uropathogenic  Escherich- ia  coli  isolates.  Clin  Microbiol  Infect,  12:88-06.

Saraylu, J., Mehrabadi, J.F., Imanifooladi,  A.A.,

Sabbaghi, A., Aghamirzaei, H.M., Hasankhani, M. (2012). Prevalence and evaluation of toxingenes among uropathogenic Escherichia coli clinical iso- lates by duplex PCR. J Med Bacteriol, 1:17–22.

Servin, A.L. (2005). Pathogenesis of Afa/Dr diffusely   adhering   Escherichia   coli.   Clin   Mi-

cro-biol Rev, 18:264–92.https://doi.org/10.1128/ CMR.18.2.264-292. PMID: 15831825.

Shetty,  A.V.,  Kumar,  S.H.,  Shekar,  M., Shetty,

A.K., Karunasagar, I. (2014). Prevalence of adhe- sive     genes   among   uropathogenic   Escherich- ia coli strains isolated from patients with urinary tract  infection in Mangalore. Indian J Med  Micro-

biol,   32:175-178.      https://doi.org/10.4103/0255-

0857.129812.     PMID: 24713907.

Siqueira, A.K., Ribeiro, M.G., Leite, D.S., Tiba,

 

M.R., deMoura, C., Lopes, M.D., Prestes, N.C., Salerno, T., da Silva, A.V.(2009). Virulence factors in Escherichia coli strains isolated from urinary tract infection and pyometra cases and from feces of

healthy dog. Res Vet Sci, 86: 206-210. https://doi. org/10.1016/j.rvsc.2008.07.018. PMID:18783807.

Slavchev, G., Pisareva, E., Markova, N.  (2009).

Virulence of uropathogenic  Escherichia  coli.  J Cult      Collect, 6:3–9.

Tramuta, C., Nucera, D., Robino, P., Salvarani, S., Nebbia, P. (2011).Virulence factors and genetic variability of uropathogenic Escherichia coli isolat- ed from dogs and cats in Italy. J Vet Sci, 12:49–

Tramuta, C., Robino, P., Nucera, D., Salvarani, S., Banche, G., Malabaila, A., Nebbia, P. (2014).

Molecular characterization and antimicrobial resis- tance of faecal and urinary Escherichia coli  isolated  from  dogs  and  humans  in  Italy.  Vet Ity,

PMID:  24715590.

Usein, C.R., Damian, M., Tatu Chitoiu, D., Ca- pusa, C., Fagaras, R., Tudorache, D., Nica, M Le Bouguénec, C. (2001). Prevalence of virulence gene in Escherichia coli strains from Romanian

adult urinary tract infections cases. J Cell Mol Med, 5:303310.  PMID: 12067489.

Yamamoto,   S.,   Tsukamoto,T.,   Kurazono,  H.,

Takeda, Y., Yoshida, O .(1995). Distribution of viru- lence factors in Escherichia coli isolated from urine of  cystitis  patient.  Microbiol  Immunol,   39:401–

Zhuge, X., Jiang, J., Pan, Z., Hu, L., Wang,    S.,

Wang, H., Leung, F.C, Dai, J., Fan, H. (2014).

Comparative Genomic Analysis Shows That Avian Pathogenic Escherichia coli Isolate IMT5155 (O2:K1:H5; ST Complex 95, ST140) Shares Close Relationship with ST95 APEC O1:K1 and

Human ExPEC O18:K1 Strains. Plos One, 9:11 1-16 e112048. https://doi.org/10.1371/journal. pone.0112048.   PMID: 25397580.