Document Type : Genetics - Immunology
Dogs are perhaps the most favoured do- mestic animal among all the pet animals. In developed countries, companion animals have become an integral part of the house- hold (Chomel and Sun, 2011). Companion animals, especially dogs, suffer from vari- ous bacterial diseases affecting urinary tract leading to malfunctioning of this system, followed by critical medical emergency or death of the animal (Davison et al., 1999). Bacterial urinary tract infections (UTIs) are the most common cause of urinary tract disease in dogs. Approximately 14% of all dogs will acquire bacterial UTIs during their lifetimes with variable age of onset (Os- borne, 1999).
Escherichia coli (E. coli) is the most prevalent and important causative agent of UTIs in dogs and humans, strains of this spe- cies are often abundant in the gastrointes- tinal tract at the time of infection (John- son et al., 2003; Momoh et al., 2011; Tramuta et al., 2011 Saraylu et al., 2012).
However, E. coli that are associated with UTIs are commonly named uropathogenic isolates (UPEC), although there is evidence that different pathotypes may be related to UTIs (Marrs et al., 2005). Urinary tract in- fections are mostly common in dogs, but clinical signs are often minimal, and the infection may go undetected (Ling, 1995). Uropathogenic Escherichia coli is one of the most common bacteria isolated from canine and feline UTIs (Osugui et al., 2014).
Uropathogenic Escherichia coli con- tain several virulence factors that facili- tate its colonization and invasion of host cells (Ejrnæs, 2011; Kudinha etal, 2012; Agar- wal et al., 2013). Surface virulence factors (ad- hesins) of UPEC are among the most im- portant virulence factors (Ni -
cole, 2008; Bien et al., 2012).The main attachment factor, P fimbriae are particularly associated with pyelonephritis and are en- coded by pap genes (Jadhav et al., 2011). Another adhesion that acts as a virulence factor is S fimbrial adhesion, which is cod- ed by sfa genes (Bien et al., 2012; Pobie- ga et al., 2013). Also, afimbrial adhesions (afa) of E. coli, coded by afa genes, have been reported in cases of pyelonephri- tis (Servin, 2005). Other important viru- lence factors of UPEC strains are the tox- ins that act as secretory virulence factors (Bien et al., 2012). The most important secre- tory virulence factor is A-hemolysin (hlyA), which is encoded by the hly gene. Also, cy- totoxic necrotizing factor 1 (cnf1) is reported in a third of pyelonephrogenic strains (John- son, 1991). Other virulence factors also have important roles in the development of UTIs, including serum resistance ability due to the outer membrane protein traT encoded by traT genes (Mellata et al., 2003; Kawamu- ra-Sato et al., 2010). Aerobactin is a bacterial siderophore encoded by aer genes and has re- cently been documented as a viru- lence factor in UPEC strains (Slaychev et al., 2009). The virulence factors are car- ried by pathogenicity islands (PAIs), which are mobile genetic elements that con- tribute to the horizontal transfer of viru- lence determinants (Hacker et al., 1997; Sa- bate et al., 2006). Phylogenetic analyses showed that E. coli strains and virulence genes were divided into four major phy- logenetic groups (A, BI, B2, and D) based on their genetic polymorphisms (Cler- mont et al., 2000). It is known that the ex- pression of virulence genes and phylotypes varies with geographical location (Agarw- al et al., 2013). However, phylogenetic char-
acterization is an important tool to improve the understanding of E. coli populations and their relationship between strains and dis- ease (Coura et al., 2015). Molecular charac- terization of E. coli virulence genes that are associated with UTIs in dogs has been stud- ied in America and most parts of the world. However, in India, there is relatively less documented information on E. coli virulence genes associated with UTIs in dogs. The cur- rent study aimed to determine the virulence genes and their phylogenetic grouping in E. coli isolates from dogs with UTIs.
From February 2017 to January 2018, a total of 103 urine samples were collect- ed aseptically through cystocentesis from dogs that were diagnosed with urinary tract infection in small animal section of Veteri- nary Clinical Complex (VCC), Lala Lajpat Rai University of Veterinary and Animal Sciences (LUVAS) Hisar Haryana, India.
The fresh urine samples collected asep- tically were inoculated and streaked onto a 5% sheep blood agar (BA) (HiMedia, Mum- bai, India) and MacConkey’s lactose agar (MLA) (HiMedia, Mumbai, India) plates separately with the help of a 4 mm diame- ter platinum loop. The plates were incubat- ed aerobically at 37°C for 24-48h till ad- equate growth was observed. Suspect- ed colonies were streaked onto Eo- sine Methylene Blue agar (EMB), (HiMe- dia, Mumbai, India) which is a selective medium for E. coli and the plates were incubated aerobically at 37°C for 24h. The appearance of blue, green colonies with a metallic luster on EMB was presumptive- ly considered as indicating the presence of
Escherichia coli.
Escherichia coli was identified using Gram staining technique. Samples with rod-shaped arrangements were subjected to biochemical tests. (Indole, Methyl Red, Voges Proskauer, Citrates tests, Glucuro- nidase, Nitrate reduction, ONPG, Lysine utilization, Lactose, Glucose, Sucrose and Sorbitol) using commercially KB010 HiE. coliTM Identification Kit (HiMedia Mum- bai, India) following the manufacturer’s in- structions.
DNA of Escherichia coli from all the positive isolates was extracted using com- mercial available PureLinkTM Genom- ic DNA mini kit (Invitrogen, USA) fol- lowing the manufacturer’s instructions as shown below.
DNA of Escherichia coli from all the positive isolates was extracted using com- mercial available PureLinkTM Genomic DNA mini-kit (Invitrogen, USA). Brief- ly, overnight grown culture in BHI broth (10 ml) was centrifuged at 10000 rpm for 10 min at 4°C. Supernatant was discarded and pellet was re-suspended in 200μl of di- gestion buffer. Then 20μl of proteinase K was added and vortexed vigorously. The solution was then transferred into 2ml mi- cro centrifuge tube and incubated in water bath (Bench Top Lab System, USA) for 2 h at 55°C. A total 200μl of both lysis/binding buffer and absolute ethanol was then added and each tube was carefully vortexed in or- der to mix the contents of the tube evenly. The solution was then carefully transferred into a PureLinkTM column and then centri- fuged. Five hundred microliters (500μl) of buffer I was added to the samples, mixed and centrifuged for 2 min at 12000 rpm,
the wash trough was discarded. Then 500μl of buffer II was added and the column was centrifuged for 2 min at 12000 rpm, the wash trough was discarded and the empty column was centrifuged for 2 min. The col- umn was then transferred into a fresh 1.5ml micro centrifuge tube. Finally, for eluting the DNA, 30μl of elution buffer was add- ed at the centre of the column, the column was incubated for 10 min at room tempera- ture and then centrifuged at 12000 rpm for 2 min. The flow through was collected in a 1.5ml micro centrifuge tube as the DNA. The obtained DNA was stored at -20 °C for further use.
The presence of virulence genes in E. coli DNA extracts was determined by con- ventional PCR (Manage et al., 2019). Prim- ers sequences, target genes, products size, and references are given in Table 1. The conventional PCR was performed in veriti thermo cycler (ABI, USA) in 25 volume re- action containing 6 µl of template DNA, 1µl of each of the primers (10 pmoles), 12.5 µl Phusion PCR Master-mix (2X) (High Fi- delity, USA), 1µl DMSO and 3.5 µl of nu- clease-free water. Amplification procedure consisted of initial denaturation at 98 °C for 30 s, followed by 35 cycles of denaturation at 98 °C for 10 s, annealing at 60 °C for 30 s, extension at 72°C for 30 s and a final extension at 72°C for 5 min. The PCR prod- ucts were analyzed on 1.5% agarose gel electrophoresis and visualized under UV trans-illuminator GEL-DOC™ (BIO-RAD, India) and documented by photography for further analyses.
The PCR products obtained were pu-
rified using PureLinkTM Quick Gel Ex- traction Kit (Invitrogen, Germany) and the cycle sequencing reactions were per- formed in a total volume of 10µl us- ing Big Dye Terminator v 3.1 Cycle Sequenc- ing Kit (ABI, USA) in automated DNA se- quencer (Applied Biosystem 3130XL Genetic Analyzer). The DNA sequencing was per- formed in both directions with the PCR prim- ers as sequencing primers (Table 1).
The resulting sequences obtained from the sequencer were used to make Contigs using SeqMan program in Lasergene suite (version 5). The contigs were then com- pared with those reported in GenBank (NCBI) by a BLAST search online. Clustal W (Bioedit software ver 9.0) was used for multiple sequence alignment, and Mega 6.0 bioinformatics sequence analysis tool was used for phylogenetic studies.
Vassarstat was used for the analysis of confidence interval (proportion).
Examination of a total of 103 urine sam- ples from dogs suffering from UTIs for detec- tion of Escherichia coli revealed 25 (24.3%) positive isolates.
The cultural growth on MacConkey lactose agar was seen as typical purple/pink colonies. However, the positive isolates were further confirmed as E. coli by inoculation on Eo- sine-Methylene blue agar medium.
Microscopic examination of gram stained colonies shows a gram negative rod-shaped arrangement. The biochemical test showed that E. coli were positive for Indole, Methyl red, Glucuronidase, Nitrate, ONPG, Lysine utilization, Lactose, Glucose, Sucrose, and Sorbitol. On the other hand, all the strains were negative for Voges-Proskauer’s and Ci-
Table 1. Primers for conventional PCR assays
|
Target
Genes |
Primers Sequences |
Product Size (bp) |
References |
|
cnf1 |
F: AAGATGGAGTTTCCTATGCAGGAG R: CATTCAGAGTCCTGCCCTCATTATT |
498 |
(Falbo et al.,1992) |
|
cnf2 |
F:GTGAGGCTCAACGAGATTATGCACTG R:CCACGCTTCTTCTTCAGTTGTTCCTC |
839 |
(Pass et al.,2000) |
|
Pap |
F: GCAACAGCAACGCTGGTTGCATCAT R: AGAGAGAGCCACTCTTATACGGACA |
336 |
(Yamamoto et al., 1995) |
|
Aer |
F: TACCGGATTGTCATATGCAGACCGT R: AATATCTTCCTCCAGTCCGGAGAAG |
602 |
(Herrero et al., 1988) |
|
Afa |
F: GCTGGGCAGCAAACTGATAACTCTC R: CATCAAGCTGTTTGTTCGTCCGCCG |
750 |
(Le Bouguenec et al., 1992) |
|
sfa |
F: CTCCGGAGAACTGGGTGCATCTTAC R: CGGAGGAGTAATTACAAACCTGGCA |
410 |
(Le Bouguenec et al., 1992) |
|
hly |
F: AACAAGGATAAGCACTGTTCTGGCT R: ACCATATAAGCGGTCATTCCCGTCA |
1177 |
(Nam et al., 2013) |
trate utilization test.
Of the 25 E. coli isolates assayed, 20(80.0%) showed the presence of aer, while 14 (56.0%), 12(48.0%), 8(32.0%) and 5(20.0%) were
found to have pap, sfa, afa, cnfI and hly genes respectively. No cnf2 gene was found in any of the E. coli isolates tested (Table 2).
The aer, afa, cnf1, hly, sfa, and pap gene se-
quences show the highest nucleotide similar-
ity of 99% with several strains retrieved from the GenBank data base.
hly, sfa, cnf1, and pap gene sequence were highly similar to the sequences that were associated with the phylogenetic group B2 whereas aer gene sequences showed maxi- mum similarity to the one in B2 and D phy- logenetic group and afa sequence grouped within the phylogenetic group A.
Table 2. Distribution of virulence genes of E. coli isolated from 25 dogs diagnosed with UTIs in Hisar Haryana, India.
|
Virulent genes |
(%) No. of isolates |
Proportion |
95% CI (Lower Limit) |
95% CI (Upper Limit) |
|
CnfI |
5 |
0.0485 |
0.0209 |
0.1086 |
|
cnf2 |
0 |
0.0 |
0.0 |
0.0 |
|
Pap |
14 |
0.1359 |
0.0827 |
0.2153 |
|
Aer |
20 |
0.1942 |
0.1294 |
0.281 |
|
Afa |
8 |
0.0777 |
0.0399 |
0.1459 |
|
Sfa |
12 |
0.1165 |
0.0679 |
0.1927 |
|
Hly |
5 |
0.0485 |
0.0209 |
0.1086 |
Figure 1. Agarose gel electrophoresis of aer and pap
Figure 2. Agarose gel electrophoresis of sfa and afa
Figure 3. Agarose gel electrophoresis of cnf1 and hly
Figure 4. Agarose gel electrophoresis of cnf2
Distribution of virulence factor gene as- sociated with canine UTIs has not been pre- viously determined and characterized in the study area (Hisar, India). The presence of the most common virulence genes such as aer, pap, sfa, afa, and hly detected in E. coli strains isolated in the present study estab- lished the pathogenic potentials of E. coli in dog’s urogenital infections.
Aerobactic receptor gene, coded by aer, promotes bacterial growth in the limiting iron concentration encountered during in- fection and act as a virulence factor in the pathogenesis of UTIs (Mittals et al., 2014). However, iron is necessary for E. coli metab- olism (Siqueira et al., 2009). Growth under iron-restricted conditions requires bacterial mechanisms that successfully compete with the host for the ion (Emody et al., 2003). Escherichia coli organism uses ion for ox- ygen transport and storage, DNA synthesis, electron transport, and peroxide metabolism (Siqueira et al., 2009). The aer virulent gene may be relevant during bacterial spreading from the urinary tract to the bloodstream (Garcia and Le Bouguenec, 1996). The aer virulent gene was seen in 80.0% of the iso- lates in the present study, this is because aer
is a virulence factor in UPEC strains. Simi- larly, Slaychev et al. (2009) found compara- ble gene in their study as a virulent factor. In other studies, the detection of aer has been reported to be more than 30.0% and 56.0% (Firoozeh et al., 2014; Munkhdelger et al., 2017), which is in concordance with the current study. Furthermore, Drazenovich et al. (2004) also found aer in 30.0% from E. coli strains isolated with persistent UTIs in dogs. The present study demonstrated high occurrence of aer genes in uropathogenic E. coli strains suggesting that the frequencies of iron acquisition system genes vary according to the geographical locations.
In the current study, most of the uropatho- genic E. coli was isolated from the urinary tract of dogs. This finding agrees with the findings of Siqueira et al. (2009), in which they documented that adhesion and coloni- zation of the uroepithelium is the most im- portant phenomenon involving uropathogen- ic E. coli. However, these adhesions promote bacterial adherence and are indispensable for the infection to be established as was report- ed by (Johnson, 1991; Emody et al., 2003; Marrs et al., 2005). P fimbria, encoded by pap, could probably contribute to the ad- hesion and colonization of the urinary tract because this virulence gene is always associ-
ated with pyelonephritis (Usein et al., 2001; Chen et al., 2003; Jacobsen et al., 2008).
In the present study, pap was found in 56.0% E. coli strains isolated from canine urinary tract infections cases indicating that E .coli isolates from the urine of dogs and cats have greater ability to colonize kidney and generate pyelonephritis (Antao et al., 2009). Shetty et al. (2014) reported that 60.87% of the uropathogenic strains of E. coli obtained from humans showed pap genes. Siquieira et al. (2009) found 23.5% papC positive strains among the E. coli strains isolated from dogs suffering from UTIs. Whereas Tramuta et al. (2014) identified pap in 13.4% E. coli iso- lates obtained from dog urine.
The S fimbriae adhesion (sfa) was found in 48.0% of the isolates obtained from UTIs in- fected dogs. This result is consistent with the occurrence of sfa (45.2%) in clinical isolates of human origin (Rahman and Deka, 2014). Similar findings were recorded in previous studies in dogs (Coogan et al., 2004; Sique- ira et al., 2009). In recent studies involving dogs (Tramuta et al., 2014) and human (Adib et al., 2014), sfa genes were found in more than 20.0% of UTI isolates studied. The demonstration of sfa gene in dog’s urine was observed in 52.0% of the isolates in anoth- er study (Drazenovich et al., 2004). Like- wise, more than 12.0% of the E. coli strains from cats show sfa genes. Further, Shetty et al. (2014) also observed the presence of sfa gene in 39.1% isolates obtained from human UTIs. Therefore, these findings highlight that sfa gene plays a vital role in both adhesions to the urogenital epithelium and the develop- ment of urinary tract infection in companion animal, especially dogs.
Afimbrial adhesion (afa) gene was found to be implicated in developing nephritis in human (Mulvey, 2002). In the current study,
afa gene was found in high frequency in the
E. coli isolates (32.0%) as compared with strains from another study in dogs with UTIs (6.0%) (Drazenovich et al., 2004), but found lower in frequency in E. coli isolates report- ed from humans, 39.1% and 64.0% (Yama- moto et al., 1995; Shetty et al., 2014). On the other hand, Ebadi et al. (2017) reported that 9.3% of the E .coli strains identified from hu- man clinical samples showed fimbrial genes (afa BC). However, Dr adhesion family rec- ognize human receptors on erythrocytes and other tissues (Mulvey, 2002), and this may explain the low incidence of this ‘A’ fimbrial adhesion factor observed in canine isolates as previously reported (Siqueira et al., 2009). Uropathogenic E. coli strains isolated from a dog with UTI express the presence of cytotoxic necrotizing factor 1 (cnf1) and Alpha-haemolysin gene (hly). The hly gene is a pore-forming toxin that lyses not only erythrocytes of all mammals and even that of fishes (Johnson, 1991) but also leukocytes, endothelial and renal epithelial cells (Usein et al., 2001; Emody et al., 2003). Alpha-hae- molysin gene (hly) was found present in 20.0% of the UTI isolates of the current study, similarly, Tramuta et al. (2014), Rah- man and Deka (2014), Liu et al. (2017) and Rashki et al. (2017) also recorded 18.0%, 36.8%, 39.0% and 10.0% of hly gene in UTIs isolates in dogs and humans respec- tively. In another study, Drazenovich et al. (2004) demonstrated that the hly gene was found in 50.0% of the E. coli isolates recov- ered from the urine of dogs. Siqueira et al. (2009) also found that 33.3% of the canine
isolates contained hly genes.
Cytotoxic necrotizing factor 1 (cnf1) is a toxin that can cause reorganization of actin microfilament in eukaryotic cells. The cy- totoxin may facilitate the bacterial invasion
of the bloodstream as a result of interfer- ence with polymorpho-nuclear phagocyto- sis and even evokes apoptotic death of epi- thelial cells in the bladder (Oelschlaeger et al., 2002; Emody et al., 2003). In the pres- ent study, cnf1 was found in 20.0% of the UTIs strains. This was less than what was reported by Rahman and Deka (2014) who found 61.9% of the isolates from humans UTIs produce cnf1 genes. Drazonavich et al. (2004) reported cnf1 genes in 50. 0% of the
E. coli isolates from dogs.
Furthermore, Johnson et al. (2003) report- ed that 41.0% of E. coli isolates obtained from canine UTIs produce cnf1. Liu et al. (2017) found 46.6% of the isolates contained cnf1. However, the results of the current study show less occurrence of cnf1 in the E. coli isolates. This could probably be attribut- ed to the mutation of this gene or could be due to variation in the geographical distribu- tion of these genes.
In the present study, none of these E. coli isolates harbored the gene that encodes cy- totoxic necrotizing factor 2 (cnf2), which is also related to UTIs. In contrast, Rahman and Deka (2014) found cnf2 in E. coli iso- lates obtained from humans suffering from UTIs. These results indicate that cnf2 may probably be of less significant in the uro- pathogenic E. coli pathogenesis in canine.
The phylogenetic analysis revealed that afa, aer, sfa, cnf1, hly, and pap genes exhib- ited 99% identity with the different variants in several geographical regions of the world. The E. coli falls into four leading phylogenet- ic groups: A, B1, B2, and D (Clermont et al., (2000). In the present study, the phylogenet- ic comparisons of virulence gene sequenc- es show that sfa, cnf1, hly and pap genes matched group B2 and, these results are con- sistent with the findings noted by other inves-
tigators (Tramuta et al., 2011; Munkhdelger et al., 2017; Coura et al., 2018). However, aer virulence gene was found to match both B2 and D phylogenetic group. This is consis- tent with the previous study that demonstrat- ed that aer sequence belongs to B2 and D phylogenetic group (ZhuGe et al., 2014; Liu et al., 2015). Moreover, only afa virulence gene sequence was found to fall within phy- logenetic group A. This is also in accordance to recent studies, where it has been shown that afa gene sequence was observed to be associated to phylogenetic group A (Marti et al., 2017; Munkhdelger et al., 2017).
In the current study, majority of the viru- lence gene sequences were found to be as- sociated with the phylogenetic group B2, suggesting that these strains were more vir- ulent than others. Similar outcomes were observed in a recent study conducted by Pi- atti et al. (2008) who found an association between virulence factors and phylogenetic group in urinary E. coli strains isolated in hu- mans. Furthermore, most of the extraintes- tinal pathogenic E. coli (ExPEC), including those with the most robust virulence factors repertories and those which are best able to infect non-compromised hosts, are de- rived from phylogenetic group B2 (Johnson, 2002). Group D contains the second-highest number of ExPEC, extraintestinal isolates. This group typically have somewhat fewer virulence factors and a different mix of viru- lence factors than group B2 isolates. E. coli strains belonging to group A and B1 do not frequently cause extraintestinal infection. These strains that are not highly virulent cause disease only in immunocompromised hosts, and could be pathogenic in healthy hosts only if they were to acquire sufficient extraintestinal virulence factors (Johnson, 2002).
In conclusion, the results of the present study demonstrated a high occurrence of vir- ulence genes. The phylogenetic comparisons of these gene sequences detected in UPEC isolated from dogs showed high similarity to those present in the urine of humans with urinary tract infection. Therefore, the pres- ent study supports the assertion that dogs may serve as a reservoir for human infection with pathogenic E. coli. The phylogenetic comparison showed that hly, sfa, cnf1, and pap virulence genes matched to group B2, afa to A and aer to group B2 and D, indicat- ing B2 as the dominant phylogenetic group among UPEC strains in Hisar, Haryana and virulence-associated genes were mostly dis- tributed in this group. Further studies are re- quired on virulence genes and their specific phylogenetic background with a large num- ber of samples to advance our understanding of uropathogenic E. coli in companion an- imals especially dogs, and this may help in controlling urinary tract infection in future.
This work was financed by the Indian Council for Cultural Relations (Ministry of External Affairs, Government of India) and Department Veterinary Medicine, LUVAS, Hisar, Haryana.
The authors declare that there is no con- flict of interest.
Adib, N., Ghsnbarpour, R., Solatzadeh, H., Al- izade, H. (2014). Antibiotic resistance profile and virulence genes of uropathogenic Escherichia coli isolates in relation to phylogeny. Trop. Biomed, 31:
17-25. PMID: 24862040
Agarwal, J., Mishra, B., Srivastava, S., Srivas- tava, R. (2013).Genotypic characteristics and bio-
films formation among Escherichia coli isolates
from Indian women with acute cystitis. Royl. So- cieties Tropical. Med. Hyg, 107: 165-169. https:// doi.org/10.1093/trstmh/trs090. PMID: 23296752.
Antao, E.M., Wieler, L.H., Ewers, C. (2009).
Adhesive threads of extraintestinal pathogenic Escherichia coli. Gut pathol, 1: 22. https://doi. org/10.1186/1757-4749-1-22. PMID: 20003270.
Bien, J., Sokolova, O., Bozko, P. (2012). Role
of uropathogenic Escherichia coli virulence fac- tors in development of urinary tract infection and kidney damage. Intern. J. Nephrol, 1– 15. Article
ID 681473. https://doi.org/10.1155/2012/681473. PMID: 22506110.
Chen, Y.M., Wright, P.J, Lee, C., Browning, G.F.
(2003). Uropathogenic virulence factors in isolated of Escherichia coli from clinical cases of canine pyometra and feces of healthy bitches. Vet. Mi-
crobiol, 94: 57–69. https://doi.org/10.1016/s0378- 1135(03)00063-4. PMID: 12742716.
Chomel, B.B., Sun, B. (2011). Zoonoses
in the bedroom. Emerg. Infect. Dis, 17: 167- 172.https://doi.org/10.3201/eid1702.101070. PMID: 21291584.
Clermont, O., Bonacorsi, S., Bingen, E. (2000).
Rapid and simple determination of the Escherichia coli phylogenetic group. Appl Environ. Mi-
crobiol, 66: 4555-4558. https://doi.org/10.1128/ aem.66.10.4555-4558.2000. PMID: 11010916.
Coogan, J.A., Oliveira, C.M., Faustino, M.,
Moreno, A.M., Vonsydow, A.C.M.D.G., Melville, P.A., Benites, N.R. (2004). Estudo microbiológico de conteúdo intrauterine de cadelas com pyome- tra epesquisa de fatores de virulência em cepas de Escherichia coli. Arquivos do Instituto Biológi- co,71: 513–51.
Coura, F.M., Diniz, S.A., Silva, M.X, Mussi,
J.M.S., Barbosa, S.M., Lage, A.P., Heinemann,
M.B. (2015). Phylogenetic group determination of Escherichia coli Isolated from Animals Samples. The scientific world, 1 4, Available from: <https:// www. hindawi.com/journals/tswj/2015/2584 24.
https://doi.org/10.1155/2015/258424.
Coura, F.M., Diniz, A.N., Junior, C.A.O., Lage,
A.P., Lobato, F.C.F., Heinemann, M.B., Silva, R.O.S. (2018). Detection of virulence genes and the phy- logenetic groups of Escherichia coli isolated from dogs in Brazil Ciencia Rural, Santa Maria, 48: 1-6.
https://doi.org/10.1590/0103-8478cr20170478.
Davison, A.M., Cumming, A.D., Swainson, C.P., Turner, N. (1999). Disease of the kidney and urinary system. in Davidson’s: Principles and Practice of Medicine.18th edn. Haslett C, Chilvers ER, Hunter JAA, Boon NA. (eds) Edinburgh: Churchill Living- stone (UK), 417- 470.
Drazenovich, N., Ling, G., Foley, J. (2004). Mo- lecular investigation of Escherichia coli strains associated with apparently persistent urinary tract infection in dogs. J Vet. Intern Med, 18:301- 306.
PMID: 15188815.
Ebadi, M., Askari, N., Jajarmi, M., Ghanbarpour,
R. (2017). Detection of Fimbrial Genes, Antibiotic Resistance Profile and Phylogenetic Background of Uropathogenic E. coli Isolated from Clinical Sam- ples in Karaj City, Iran J Med. Bacteriol, 6:15-20.
Ejrnæs, K. (2011). Bacterial characteristics of importance for recurrent urinary tract infections caused by Escherichia coli. Dan Med Buletin, 58:1–
22. PMID: 21466767.
Emödy, L., Kerényi, M., Nagy, G. (2003). Vir- ulence factors of uropathogenic Escherichia coli.
Intern. J Antimicrob Agents, 22:29–33. https:// doi.org/10.1016/s0924-8579(03)00236-x. PMID: 14527768.
Falbo, V., Famiglietti, M., Caprioli, A. (1992).
Gene block encoding production of cytotoxic nec- rotizing factor 1 and hemolysin in Escherichia coli isolates from extraintestinal infections. Infect Im-
mun, 60:2182-7. PMID: 1587586.
Firoozeh, F., Saffari, M., Neamati, F., Zibaei, M. (2014). Detection of virulence genes in Escherichia coli isolated from patients with cystitis and pyelone-
phritis. Intern J Infect Dis, 29: 219–222. https://doi. org/10.1016/j.ijid.2014.03.1393. PMID: 25449257.
Garcia, M. I., Le Bouguénec, C. (1996). Role
of adhesion in pathogenicity of human uropatho- genic and diarrhoeogenic Escherichia coli. Bul-
letin of Institute Pasteur, 94:201–236. https://doi. org/10.1016/S0020-2452(97)86017-4.
Hacker, J., Blum-Oehler, G., Muhldorfer, I.,
Tschape. (1997). Pathogenicity islands of virulent bacteria: structure, function and impact on microbi-
al evolution. Mole Microbiol, 23:1089–97. https:// doi.org/10.1046/j.1365-2958.1997.3101672.x PMID: 9106201.
Herrero, M., de Lorenzo, V., Neilands, J.B.
(1988). Nucleotide sequence of the iucD gene of the pColVK30 aerobactin operon and to- pology of its product studied with phoA and lacZ
gene fusions .J Bacteriol, 170:85-64. https://doi. org/10.1128/jb.170.1.56-64.1988. PMID: 3275632.
Jacobsen, S.M., Stickler, D.J., Mobley, H.L.,
Shirtliff, M.E. (2008). Complicated catheter-associ- ated urinary tract infections due to Escherichia coli and Proteus mirabilis. Clin Microbiol Rese, 21:
26-59.https://doi.org/10.1128/CMR.00019-07. PMID: 18202436.
Jadhav, S., Hussain, A., Devi, S., Kumar, A.,
Parveen, S., Gandham, N. (2011).Virulence charac- teristics and genetic affinities of multiple drug re- sistant uropathogenic Escherichia coli from a semi urban locality in India. Plos One, 6:e18063.
https://doi.org/10.1371/journal.pone.0018063. PMID: 21464963.
Johnson, J.R., Kaster, N., Kuskowski, M.A.,
Ling, G.V. (2003). Identification of urovirulence traits in Escherichia coli by comparison of uri- nary and rectal E. coli isolates from dogs with urinary tract infection. J Clin Microbiol, 41:337-
45.https://doi.org/10.1128/jcm.41.1.337-345. PMID: 12517870.
Johnson, J.R. (1991).Virulence factors in Esch- erichia coli urinary tract infection. Clin Micro- biol Rev, 4: 80–128. doi: 10.1128/cmr.4.1.80.
PMID: 1672263.
Johnson, J.R. (2002). Evolution of pathogenic Escherichia coli. In: Donnenberg M (ed.). Esch- erichia coli: Virulece Mechanism of a Versatile Pathogen. 1st ed. pp. 55-77, Academic Press, San Diego.
Kawamura-Sato, K.Yoshida, R., Shibayama, K., Ohta, M. (2010).Virulence genes, quinolone and fluoroquinolone resistance, and phylogenic back- ground of uropathogenic Escherichia coli strains isolated in Japan. Japan J Infect
Dis, 63:113–5. PMID: 20332573.
Kudinha, T., Kong, F., Johnson, J., Andrew, S., Anderson, P., Gilbert. G. (2012). Multiplex PCR based reverse line blot assay for simultaneous detection of 22 virulence genes in uropathogenic Escherichia coli. Appl Environ Microbiol, 78:1198–
Le Bouguenec, C., Archambaud. M., Labigne,
PMID: 1349900.
Ling, G. (1995). Lower Urinary Tract Diseases of Dogs and Cats. St Louis, MO: Mosby.
Liu, C., Zheng, H., Yang, M., Xu, Z., Wang,
X., Wei, L., Tang, B., Liu, F., Zhang, Y., Ding, Y.,
Tang, X.,Wu, B,T.J., Johnson, T.J., Chen, H., Tan,
C. (2015). Genome analysis and in vivo virulence of porcine extraintestinal pathogenic Esche- richia coli strain PCN033. BMC Gen, 16:118. doi:
10.118 6/s12864-015-1890-9. PMID: 26391348. Liu, X., Liu, H., Li, Y., Hao, C. (2017). Asso-
ciation between virulence profile and fluoroquino- lone resistance in Escherichia coli isolated from dogs and cats in China. J Infect Devel Contri,
11:306- 313.https://doi.org/10.3855/jidc.8583. PMID: 28459221.
Manage, D. P., Lauzon, J., Jones, C. M., Ward, P.
J., Pilarski, L. M., Pilarski, P. M., McMullen, L. M. (2019). Detection of pathogenic Escherichia coli on potentially contaminated beef carcasses using cas- sette PCR and conventional PCR. BMC microbiol-
ogy, 19: 175. https://doi.org/10.1186/s12866-019-
Marrs, C.F., Zhang, L., Foxman, B. (2005). Esch- erichia coli mediatedurinary tract infections: Are there distinct uropathogenic E. coli (UPEC) pathotypes? FEMS Microbiol Lett, 252:183- 190.
https://doi.org/10.1016/j.femsle.2005.08.028. PMID: 16165319.
Marti, R., Schmid, M., Kulli, S., Schneeberger,
K., Naskova, J., Knøchel, S., Ahrens, C.H., Hummerjohanna, J. (2017). Biofilm formation po- tential of heat resistant Escherichia coli dairy isolates and the complete genome of multidrug re- sistant, heat resistant strain FAM21845. Appl
Environ Microbiol, 83: 15, 1-20. E00628- 17.https://doi.org/10.1128/AEM.00628-17. PMID: 28550056.
Mellata, M., Dho-Mouli, M., Dozois, C.M.,
Curtiss, R., Brown, P.K., Arne, P. (2003). Role of virulence factors in resistance of avian patho- genic Escherichia coli to serum and in pathog In-
fec Immunol,71:536–40.https://doi.org/10.1128/ iai.71.1.536-540.2003. PMID: 12496207.
Mittals, S., Sharma, M., Chaudhary, U. (2014). Study of virulence factors of uropathogenic Escherichia coli and its antibiotics susceptibili- ty pattern. Indian J Pathol Microbiol, 57:61-64.
https://doi.org/ 10.4103/0377-4929.130899. PMID: 24739833.
Momoh, A.R.M., Orhue, P.O., Idonije, O.B.,
Oaikhena, A.G., Nwoke, E.O. (2011). The anti- biogram types of Escherichia coli isolated from suspected urinary tract infection samples. J Micro- biol Biotech Res, 1:57-65.
Mulvey, M.A. (2002). Adhesion and entry of uropathogenic Escherichia coli. Cell Microbiol 4: 257–271.
Munkhdelger, Y., Gunregjav, N., Dorjpurev, A., Juniichiro, N., Sarantuya, J. (2017). Detection of virulence genes, phylogenetic group and antibiotic resistance of uropathogenic Escherichia coli
in Mongolia. Infect Dev Ctries, 11:51-57. https:// doi.org/10.3855/jidc.7903. PMID: 28141590.
Nam, E.H., Sungjin, K., Joon Seok, C., Cheol
Yong, H. (2013). Characterization and zoonotic potentials of uropathogenic E.coli isolates from dogs. J. Micrcobiol. Biotech, 23:422-429.
doi:10.4014/jmb.1209.09051. PMID: 23462017.
Nicolle, L.E. (2008). Uncomplicated urinary tract infection in adults including uncom plicated pyelonephritis. Urol Clin North Am, 35:1–12.
https://doi.org/10.1016/j.ucl.2007.09.004. PMID: 18061019.
Oelschlaeger, T.A., Dobrindt, U., Hack- er, J. (2002).Virulence factors of uropatho-
gens. Curr Opin Urolog, 12: 33–38. https://doi. org/10.1097/00042307-200201000-00007. PMID: 11753131.
Osborne, C.A. (1999). Three Steps to Effective
Management of Bacterial Urinary Tract Infections: Diagnosis, Diagnosis, Diag. Compend, 17:1233- 1240.
Osugui, L., de Castro, A.F., Iovine, R., Irino, K., Carvalho, V.M. (2014). Virulence genotypes, antibi- otic resistance and the phylogenetic background of extraintestinal pathogenic Escherichia coli isolated from urinary tract infections of dogs and cats in Bra-
zil. Vet Microbiol, 171:242 247. PMID: 24742952. Pass, M.A., Odedra, R., Batt, R.M. (2000). Multiplex PCRs for identification of Escherichia coli virulence genes. J Clin Microbiol, 38:2001-4.
PMID: 10790141.
Piatti, G., Mannini, A., Balistreri, M., Schito,
A.M. (2008) .Virulence factors in urinary Esche- richia coli strains: phylogenetic background and quinolone and fluoroquinolone resistance. J Clin
Microbiol, 46:480-487. https://doi.org/10.1128/ JCM.01488-07. PMID: 18057134.
Pobiega, M., Wojkowska-Mach, J., Ch-
mielarczyk, A., Romaniszyn, D., Adamski, P., Hec- zko, P.B. (2013). Molecular characterization and drug resistance of Escherichia coli strains iso- lated from urine from long-term care facility res- idents in Cracow, Poland. Med Sci Monit, 19:317–
26. https://doi.org/10.12659/MSM.883898. PMID:
Rahman, H., Deka, M. (2014). Detection and characterization of necrotoxin producing Esche- richia coli (NTEC) from patients with urinary tract infection (UTI). Indian J Med Res, 139:632-
637. PMID: 24927352.
Rashki, A., Abdi, H.A., Shookohi, M. (2017). Prevalence of Genes Encoding Outer Membrane- Virulence Factors among Fecal Escherichia coli Isolates Intern J Basc Sci Med, 2:52-57.
https://doi.org/10.15171/ijbsm.11.
Sabate, M., Moreno, E., Perez, T., Andreu, A., Prats, G. (2006). Pathogenicity island mark- ers in commensal and uropathogenic Escherich- ia coli isolates. Clin Microbiol Infect, 12:88-06.
https://doi.org/10.1111/j.1469-0691.2006.01461.x PMID: 16882293.
Saraylu, J., Mehrabadi, J.F., Imanifooladi, A.A.,
Sabbaghi, A., Aghamirzaei, H.M., Hasankhani, M. (2012). Prevalence and evaluation of toxingenes among uropathogenic Escherichia coli clinical iso- lates by duplex PCR. J Med Bacteriol, 1:17–22.
Servin, A.L. (2005). Pathogenesis of Afa/Dr diffusely adhering Escherichia coli. Clin Mi-
cro-biol Rev, 18:264–92.https://doi.org/10.1128/ CMR.18.2.264-292. PMID: 15831825.
Shetty, A.V., Kumar, S.H., Shekar, M., Shetty,
A.K., Karunasagar, I. (2014). Prevalence of adhe- sive genes among uropathogenic Escherich- ia coli strains isolated from patients with urinary tract infection in Mangalore. Indian J Med Micro-
biol, 32:175-178. https://doi.org/10.4103/0255-
0857.129812. PMID: 24713907.
Siqueira, A.K., Ribeiro, M.G., Leite, D.S., Tiba,
M.R., deMoura, C., Lopes, M.D., Prestes, N.C., Salerno, T., da Silva, A.V.(2009). Virulence factors in Escherichia coli strains isolated from urinary tract infection and pyometra cases and from feces of
healthy dog. Res Vet Sci, 86: 206-210. https://doi. org/10.1016/j.rvsc.2008.07.018. PMID:18783807.
Slavchev, G., Pisareva, E., Markova, N. (2009).
Virulence of uropathogenic Escherichia coli. J Cult Collect, 6:3–9.
Tramuta, C., Nucera, D., Robino, P., Salvarani, S., Nebbia, P. (2011).Virulence factors and genetic variability of uropathogenic Escherichia coli isolat- ed from dogs and cats in Italy. J Vet Sci, 12:49–
55.https://doi.org/10.4142/jvs.2011.12.1.49. PMID:
Tramuta, C., Robino, P., Nucera, D., Salvarani, S., Banche, G., Malabaila, A., Nebbia, P. (2014).
Molecular characterization and antimicrobial resis- tance of faecal and urinary Escherichia coli isolated from dogs and humans in Italy. Vet Ity,
50:23-30. https://doi.org/10.12834/VetIt.1304.09.
PMID: 24715590.
Usein, C.R., Damian, M., Tatu Chitoiu, D., Ca- pusa, C., Fagaras, R., Tudorache, D., Nica, M Le Bouguénec, C. (2001). Prevalence of virulence gene in Escherichia coli strains from Romanian
adult urinary tract infections cases. J Cell Mol Med, 5:303310. PMID: 12067489.
Yamamoto, S., Tsukamoto,T., Kurazono, H.,
Takeda, Y., Yoshida, O .(1995). Distribution of viru- lence factors in Escherichia coli isolated from urine of cystitis patient. Microbiol Immunol, 39:401–
404. https://doi.org/10.1111/j.1348-0421.1995. tb02219.x. PMID: 8551971.
Zhuge, X., Jiang, J., Pan, Z., Hu, L., Wang, S.,
Wang, H., Leung, F.C, Dai, J., Fan, H. (2014).
Comparative Genomic Analysis Shows That Avian Pathogenic Escherichia coli Isolate IMT5155 (O2:K1:H5; ST Complex 95, ST140) Shares Close Relationship with ST95 APEC O1:K1 and
Human ExPEC O18:K1 Strains. Plos One, 9:11 1-16 e112048. https://doi.org/10.1371/journal. pone.0112048. PMID: 25397580.