Document Type : Genetics - Immunology
There are 27 breeds of sheep in Iran, 26 of which are fat-tailed breeds. As Iran is located in arid and semi-arid regions of the world and experiences periods of feed abundance and scarcity during the year, fat-tail adipose tissue as an energy reserve developed in native sheep breeds of Iran as an evolutionary adaptation that serves as a source of energy to increase survival during the shortage in pasture and of feed scarcity. In fat-tailed breeds, deposition of fat in tail region during feed abundant season can keep the animal alive during periods of scarcity without considerable elevation of plasma non-esterified fatty acid (NEFA) concentration. To our knowl- edge, there is no study investigating the biological pathways such as gene expres- sion of regulators and enzymes involved in adipose tissues metabolism of fat-tailed sheep breeds during periods of negative and positive energy balance. Evaluating the effect of negative and positive energy balances on gene expression might reveal the pathways involved in adipose tissue metabolism, as quantitative real time PCR (RT-qPCR) can produce data with high sensitivity and reproducibility. As stability of the reference genes varies according to type of tissue and physiological stage (Svingen et al., 2015; Kaur et al., 2018), de- fining a suitable set of reference genes is an absolute prerequisite for any RT-qPCR analysis, since a stable reference gene in various physiological and environmental conditions as an internal standard can ac- curately depict changes in expression of target genes. Moreover, several software programs have been developed to rank the reference candidate genes from the most stable to the least stable one. These soft-
ware programs have been shown to rank the reference genes differently (Najafpanah et al., 2013) due to acquisition of differ- ent algorithms (Kim et al., 2011). Hence, the objective of the current study was to evaluate the stability of 8 commonly used candidate reference genes including Glyceraldehyde 3-phosphate dehydroge- nase (GAPDH), Peptidylprolyl isomerase A (PPIA), Tyrosine 3-monooxygenase/ tryptophan 5-monooxygenase activation protein, Zeta polypeptide (YWHAZ), B-actin, Glucose-6-phosphate dehydroge- nase (G6PDH), RNA polymerase II sub- unit A (POLR2A), Phosphoglycerate ki- nase 1 (PGK1) and Beta-2-microglobulin (B2M) in adipose and muscle tissues of fat-tailed Lori-Bakhtiari male lambs under periods of negative and positive energy balance by 3 software programs including BestKeeper, NormFinder and geNorm and also consensus ranking of these software programs.
The experiment was done according to the recommendations in the Guide for the Care and Use of Laboratory Animals of the Research Station of Department of Animal Science, University of Tehran, Iran. The protocols were approved by the Animal Care and Use Committee of the University of Tehran Institutional Animal Care and Use Committee.
The experiment was carried out at the Natural Resources & Agricultural Research Farm of Tehran University, Karaj, Iran. Eighteen Lori-Bakhtiari male lambs with av- erage body-weight of 45.10 ± 3.50 and age
of 5-6 months were divided into 3 groups of 6 lambs in each treatment according to their body-weight. Lambs were placed in individ- ual pens. The experiment began after two weeks of an adaptation to pen and lasted for about 42 days. All lambs were fed a balanced total mixed ration (TMR) formulat- ed by Cornell net carbohydrate and protein system (CNCPS) software program 1.5 fold of their maintenance requirement during ad- aptation period. The diet was consisted of concentrate (44 %) and forage (56 %; alfalfa hay and wheat straw; Table S1). The amount of feed was adjusted weekly according to lambs body-weight change during the whole experiment. The lambs were fed twice daily at 8:00 and 17:00 (equal amount) and had free access to water. At the end of adaptation period, the first group (6 lambs) was random- ly selected and weighted after 16 h depriving from feed and slaughtered to collect samples of adipose tissues and longissimus dorsi mus- cle. The remained 2 groups were fed 90, 80 and 70 % of their maintenance requirement in weeks 1, 2 and 3 of the experiment re- spectively. At the end of week 3, the second group was randomly selected and slaughtered to collect samples and the remained group (group 3) was fed ad-libitum until the end of experiment (day 42) and then was slaugh- tered to collect samples. All samples were immediately frozen in liquid nitrogen, trans- ferred to the laboratory and kept at -80 °C until analysis. Lambs were weighed and bled weekly for calculation of changes in body- weight and plasma NEFA concentration.
Total RNA was extracted according to the method of Chomczynski and Sacchi (2006) using YTzol reagent (Yekta Tajhiz Azma Co., Tehran, Iran) and treated with
RNase-free DNase I in order to remove the remnant genomic DNA from the samples (TaKaRa, Shuzo, Kyoto, Japan). The RNA abundance was estimated by nanodrop spec- trophotometry at 260 nm, and the purity was checked by determining the absorption ratio at 260/280 nm. The quality of the extracted RNA was assessed by electropho- resis at 1% agarose-gel that contained ethid- ium bromide. The first-strand complementa- ry DNA (cDNA) was synthesized from 100 ng of total RNA by cDNA synthesis kit (M- MuLV Reverse Transcriptase, Cinaclon Co, Tehran, Iran, Cat No; PR911658), an oligo (dT) primer and random hexamers ac- cording to manufacturer’s instructions. The process of cDNA synthesis was initiated by annealing of the primers at 37 ºC for 1 min followed by cDNA synthesis at 42 ºC for
60 min and terminated by inactivation of the reverse transcriptase enzyme at 85 ºC for 5 min. The synthesized cDNA was kept at -20 ºC to be used later.
The nucleotide sequence of 8 candidate reference genes belonging to the sheep (Ovis aries) was obtained from public databases (GenBank, National Center for Biotechnology Information). Primer pairs were designed according to these sequenc- es (optimal Tm at 61 °C and GC between 45-50%) using primer3Plus (Untergasser et al., 2007) online software programs and the suitability of primers was evaluat- ed by OligoAnalyzer 3.1 (http://eu.idtdna. com/analyzer/applications/oligoanalyzer/) and OligoCalc (Kibbe, 2007). The speci- ficity of designed primers was examined through PrimerBLAST software of NCBI database (Ye et al., 2012). The sequence and some other characteristics of designed primers are presented in Table 1.
Table 1. The sequence and characteristics of primers used for evaluation of expression of reference genes
|
|
Accession number |
Forward and reverse sequence |
Fragment length (bp) |
Annealing temperature (º C) |
|
GAPDH |
NM_001190390.1 |
ACGCTCCCATGTTTGTGATG |
146 |
58.83 |
|
|
|
CATAAGTCCCTCCACGATGC |
|
58.13 |
|
PPIA |
NM_001308578.1 |
TTGCAGACAAAGTCCCGAAG |
121 |
58.41 |
|
|
|
CCACCCTGGCACATAAATCC |
|
58.60 |
|
YWHAZ |
NM_001267887.1 |
GTTCTTGATCCCAAACGCTTC |
119 |
57.80 |
|
|
|
CCACAATCCCTTTCTTGTCATC |
|
57.29 |
|
B-actin |
NM_001009784.1 |
TGGCACCACACCTTCTACAAC |
105 |
60.48 |
|
|
|
GGTCATCTTCTCACGGTTGG |
|
58.27 |
|
G6PDH |
NM_001093780.1 |
CAAGCTGGAGGAGTTCTTTGC |
131 |
59.46 |
|
|
|
GGTAGAAGAGGCGGTTGGTC |
|
60.11 |
|
POLR2A |
XM_004013289.3 |
GGATCAGGAGTGGGTGAATG |
110 |
57.66 |
|
|
|
TCCGGTCAGTCATGTGCTTC |
|
60.04 |
|
PGK1 |
NM_001142516.1 |
TAAGGTGCTCAACAACATGGAG |
203 |
58.59 |
|
|
|
CCATCCAGCCAACAGGTATG |
|
58.32 |
|
B2M |
NM_001009284.2 |
CAGCGTATTCCAGAGGTCCAG |
199 |
60.20 |
|
|
|
CAGCGTGGGACAGAAGGTAG |
|
60.11 |
The real-time quantitative PCR was per- formed using SYBR Green I technology on an iQ5 System (BioRad, USA). The reac- tions consisted of 10 µL SYBR Green PCR Master Mix (SYBR biopars, GUASNR, Iran), 10 pmol (1 µL) of each specific for- ward and reverse primer, 3 µL of cDNA, and 5 µL nuclease free water, for a final volume of 20 µL. Real-time quantitative PCR was performed for samples with 6 bio- logical replicates. The PCR temperature cy- cling program was an initial denaturation at 95 ºC for 15 min followed by 40 cycles at 95 ºC (denaturation, 15 sec), 62 ºC (anneal-
ing, 30 sec), and 72 ºC (elongation, 30 sec), followed by a final extension at 72 ºC for 5 min. The amplified DNA was incubated at 4 ºC, and 5.5 μL of PCR amplified product was purified using horizontal electrophore- sis in a 2% agarose gel and visualized by
ethidium bromide to confirm the specificity of amplified fragments. The efficiency of RT-PCR was assessed for each gene based on the slope of a linear regression model. The bulk of each cDNA sample was used as a PCR template to produce a graph of the cycle threshold (Ct) in a range of 10-fold dilution series. The corresponding RT-PCR efficiencies were calculated based on the slope of the standard curve using the following equation: (E=10 -1/slope-1) (Radonić et al., 2004). A melt-curve analysis was conducted for each amplification be- tween 55-95 ºC to ascertain that non-specif- ic products were not amplified. Three soft- ware programs of NormFinder, geNorm and BestKeeper were used to rank the candidate reference genes according to their stability. The arithmetic mean of the reference genes ranks by 3 software programs was calculat- ed as consensus ranking.
Data were analyzed by GLM proce- dure of SAS software (SAS 2002) to evaluate the difference in Ct value of the candidate reference genes and SAS MIXED procedure was used to analyze bodyweight and plasma NEFA concen- tration during periods of negative and positive energy balance. The difference between treatments was considered to be significant if P<0.05.
Induction of Negative energy balance
As it is shown in Figure 1, feeding 90,
80 and 70 % of maintenance requirement respectively in weeks 1, 2 and 3 of negative energy balance period significantly reduced body-weight and increased plasma NEFA concentration, hence successfully induced negative energy balance in Lori-Bakhtiari lambs. The lambs experienced the most severe negative energy balance and body- weight loss during the third week of the restricted feeding and by elimination of the restricted feeding, started to gain weight and plasma NEFA concentration was re- turned (decreased) to the basal level.
Figure 1. The bodyweight and plasma NEFA concentration changes during negative and positive energy balances
The mean Ct value with standard devi- ation and also Ct distribution of candidate reference genes are presented in Figures 2 to 7. In mesenteric adipose tissue, lowest and highest Ct values were observed with B-actin and PGK1 respectively (Figure 2). The range of the Ct value distribution was parallel to the standard deviation of the reference genes as genes with the lowest standard deviation showed Ct values dis- tributed in a narrower range (Figure 3). In fat-tail adipose tissue, the lowest Ct value was observed with B2M and PPIA, whereas POLR2A and YWHAZ showed the highest Ct value ( Figure 4). The Ct value of G6PDH showed a narrower distribution range compared to other candidate refer- ence genes in fat-tail adipose tissue (Figure 5). In longissimus dorsi muscle, G6PDH showed the lowest standard deviation (Fig- ure 6) and also had the narrowest distribu- tion (Figure 7). There was no significant change in Ct value of the reference genes in mesenteric adipose tissue (Figure 8), except for B-actin and G6PDH which in- creased as the experiment progressed (from
19.32 and 21.65 at the beginning of the experiment to 21.62 and 24.19 at the end of the experiment respectively for B-actin and G6PDH). Induction of negative energy
balance increased the Ct value of all can- didate reference genes and shifting to posi- tive energy balance reduced their Ct value, however the difference was significant only for G6PDH (P<0.02) and PGK1 (P<0.05).
The negative energy balance caused a sig- nificant enhancement in Ct value of GAP- DH, B-actin, B2M and PGK1 followed by a reduction in response to positive energy balance, whereas the Ct value of G6PDH was reduced as a consequence of negative energy balance, however, the difference was not significant.
G6PDH was the most stable gene in the mesenteric adipose tissue defined by NormFinder and geNorm software pro- grams, whereas by BESTKEEPER soft- ware, it ranked 3 and B-actin was defined as the most stable gene (Table 2). Gene expression of POLR2A, PGK1 and B2M showed the least stability in mesenteric ad- ipose tissue calculated by NormFinder and geNorm software programs and POLR2A was replaced by YWHAZ when BestKeep- er was used. Arithmetic mean of the rank- ing by 3 software programs showed that GAPDH, B-actin and PPIA were the most stable and POLR2A, PGK1 and B2M were the least stable genes in mesenteric adipose tissue during negative and positive energy balances.
Figure 2. The Ct value with standard deviation of mesenteric adipose tissue
Figure 3. The distribution of Ct value of mesenteric adipose tissue
Figure 4. The Ct value with standard deviation of fat-tail adipose tissue
Figure 5. The distribution of Ct value of fat-tail adipose tissue
Figure 6. The Ct value with standard deviation of longissimus dorsi muscle tissue
Figure 7. The distribution of Ct value of longissimus dorsi muscle tissue
Figure 8. The Ct value of reference genes in mesenteric adipose tissue in different energy balances
Table 2. The candidate genes ranked by different software programs and the consensus ranking in mesenteric depot
|
Rank of stability |
Best Keeper |
NormFinder |
geNorm |
Consensus ranking |
|
1 |
B-actin |
GAPDH |
GAPDH |
GAPDH |
|
2 |
G6PDH |
PPIA |
B-actin |
B-actin |
|
3 |
GAPDH |
YWHAZ |
PPIA |
PPIA |
|
4 |
PPIA |
B-actin |
YWHAZ |
G6PDH |
|
5 |
POLR2A |
G6PDH |
G6PDH |
YWHAZ |
|
6 |
YWHAZ |
POLR2A |
POLR2A |
POLR2A |
|
7 |
B2M |
PGK1 |
PGK1 |
PGK1 |
|
8 |
PGK1 |
B2M |
B2M |
B2M |
Ranking of 8 candidate reference genes in fat-tail adipose tissue by NormFind- er and geNorm software programs was quite similar except for B-actin and B2M which were exchanged between ranks of
5 and 8 (Table 3). PPIA, PGK1 and YWHAZ were the most stable refer- ence genes defined by NormFinder and geNorm, whereas Best Keeper calculat- ed G6PDH, YWHAZ and POLR2A as genes with least variability with YWHAZ
as the only similarity among 3 software programs. PGK1 was defined as the sec- ond stable reference gene by NormFinder and geNorm software programs, whereas it showed the least stability calculated by BestKeeper software program. Average of the ranking by 3 software programs showed that PPIA, YWHAZ and POL- R2A were the most and B-actin, GAPDH and B2M were the least stable genes in fat-tail adipose tissue.
Table 3. The candidate genes ranked by different software programs and the consensus ranking in fat-tail depot
|
Rank of stability |
Best Keeper |
NormFinder |
geNorm |
Consensus ranking |
|
1 |
G6PDH |
PPIA |
PPIA |
PPIA |
|
2 |
YWHAZ |
PGK1 |
PGK1 |
YWHAZ |
|
3 |
POLR2A |
YWHAZ |
YWHAZ |
POLR2A |
|
4 |
B-actin |
POLR2A |
POLR2A |
PGK1 |
|
5 |
PPIA |
B-actin |
B2M |
G6PDH |
|
6 |
B2M |
GAPDH |
GAPDH |
B-actin |
|
7 |
GAPDH |
G6PDH |
G6PDH |
GAPDH |
|
8 |
PGK1 |
B2M |
B-actin |
B2M |
When mesenteric and fat-tail adipose tis- sues were considered together, GAPDH, PPIA and YWHAZ were considered as the most stable genes during negative and positive energy balances by NormFinder and geNorm software programs, while by using Best Keeper, G6PDH, B-actin and
POLR2A were defined as genes with least variability (Table 4). PPIA which was de- fined as the second stable gene by Norm- Finder and geNorm software programs, was considered as a gene with low stabil- ity (ranked sixth) by BestKeeper software program. In addition, G6PDH which was
considered as the best reference gene with least variability by BestKeeper, was among
genes with the lowest stability defined by other software programs.
Table 4. . The candidate genes ranked by different software programs and the consensus ranking in adipose tissue
|
Rank of stability |
Best Keeper |
NormFinder |
geNorm |
Consensus ranking |
|
1 |
G6PDH |
GAPDH |
GAPDH |
GAPDH |
|
2 |
B-actin |
PPIA |
PPIA |
PPIA |
|
3 |
POLR2A |
YWHAZ |
YWHAZ |
YWHAZ |
|
4 |
YWHAZ |
POLR2A |
POLR2A |
POLR2A |
|
5 |
GAPDH |
B-actin |
B-actin |
B-actin |
|
6 |
PPIA |
B2M |
B2M |
G6PDH |
|
7 |
B2M |
G6PDH |
G6PDH |
B2M |
|
8 |
PGK1 |
PGK1 |
PGK1 |
PGK1 |
For longissimus dorsi muscle, G6PDH, POLR2A and YWHAZ were defined as the most stable genes by BestKeeper software program, while by NormFinder and geNorm software programs, B-ac- tin, PGK1 and YWHAZ were defined as the most stable reference genes with YWHAZ as the only similarity (Table 5). G6PDH was considered as the most stable reference gene in muscle tissue by BestKeeper program, whereas by Norm-
Finder and geNorm, it was considered as a gene with low stability. In addi- tion, GAPDH was considered as a gene with low stability by all 3 software pro- grams. Consensus ranking of all software programs defined B-actin, YWHAZ and PGK1 as the 3 most and B2M, G6P- DH and GAPDH as the 3 least stable reference genes in muscle tissue during periods of negative and positive energy balance.
Table 5. The candidate genes ranked by different software programs and the consensus ranking in skeletal muscle
|
Ranking of stability |
Best Keeper |
NormFinder |
geNorm |
Consensus ranking |
|
1 |
G6PDH |
B-actin |
B-actin |
B-actin |
|
2 |
POLR2A |
PGK1 |
PGK1 |
YWHAZ |
|
3 |
YWHAZ |
YWHAZ |
YWHAZ |
PGK1 |
|
4 |
B-actin |
PPIA |
POLR2A |
POLR2A |
|
5 |
PPIA |
B2M |
B2M |
PPIA |
|
6 |
B2M |
POLR2A |
PPIA |
B2M |
|
7 |
PGK1 |
GAPDH |
G6PDH |
G6PDH |
|
8 |
GAPDH |
G6PDH |
GAPDH |
GAPDH |
|
The ranking of |
the candidate |
reference by |
energy balance |
(Table 6). Consensus |
genes by different software programs and also the consensus ranking were affected
ranking of the software programs showed that in mesenteric adipose tissue, GAPDH
was among the 3 most stable reference genes in all periods of different energy balance, whereas B-actin was not consid- ered as a stable reference gene in negative energy balance. In fat-tail adipose tissue, the stability of reference genes was con- siderably affected by energy balance, how- ever, B-actin and PGK1 were among the
3 most stable genes in both negative and subsequent positive energy balances. When mesenteric and fat-tail adipose tissues were considered together, GAPDH was among the 3 most stable genes in all periods and then B-actin and PPIA were the most fre- quent genes selected as the 3 most stable reference genes.
Table 6. Three most stable reference genes in various tissues during neutral, negative and positive energy balances.
|
|
BestKeeper |
NormFinder |
geNorm |
Concensus ranking |
|
Mesenteric adipose tissue |
|
|
|
|
|
|
G6PDH |
GAPDH |
GAPDH |
B-actin |
|
Beginning (Neutral energy balance) |
B-actin |
B-actin |
B-actin |
GAPDH |
|
|
GAPDH |
PPIA |
PPIA |
PPIA |
|
|
GAPDH |
GAPDH |
GAPDH |
GAPDH |
|
Middle (Negative energy balance) |
G6PDH |
G6PDH |
G6PDH |
G6PDH |
|
|
B-actin |
PPIA |
PPIA |
PPIA |
|
|
POLR2A |
GAPDH |
GAPDH |
GAPDH |
|
End (Positive energy balance) |
G6PDH |
PPIA |
POLR2A |
POLR2A |
|
|
B-actin |
YWHAZ |
B-actin |
B-actin |
|
Fat-tail adipose tissue |
|
|
|
|
|
|
G6PDH |
PPIA |
PPIA |
PPIA |
|
Beginning (Neutral energy balance) |
POLR2A |
YWHAZ |
YWHAZ |
POLR2A |
|
|
PPIA |
POLR2A |
POLR2A |
YWHAZ |
|
|
G6PDH |
B-actin |
B-actin |
B-actin |
|
Middle (Negative energy balance) |
B-actin |
G6PDH |
G6PDH |
G6PDH |
|
|
POLR2A |
GAPDH |
GAPDH |
PGK1 |
|
|
G6PDH |
B-actin |
PGK1 |
B-actin |
|
End (Positive energy balance) |
YWHAZ |
PGK1 |
B-actin |
YWHAZ |
|
|
B-actin |
YWHAZ |
PPIA |
PGK1 |
|
All adipose tissue |
|
|
|
|
|
|
G6PDH |
PPIA |
PPIA |
PPIA |
|
Beginning (Neutral energy balance) |
B-actin |
B2M |
B2M |
GAPDH |
|
|
POLR2A |
GAPDH |
GAPDH |
B2M |
|
|
GAPDH |
GAPDH |
GAPDH |
GAPDH |
|
Middle (Negative energy balance) |
B-actin |
PPIA |
B-actin |
B-actin |
|
|
PPIA |
YWHAZ |
YWHAZ |
PPIA |
|
BestKeeper |
NormFinder |
geNorm |
Concensus ranking |
|
|
G6PDH |
B-actin |
B-actin |
B-actin |
|
End (Positive energy balance) |
B-actin |
GAPDH |
POLR2A |
POLR2A |
|
|
YWHAZ |
PPIA |
PPIA |
GAPDH |
|
Longissimus dorsi muscle |
|
|
|
|
|
|
G6PDH |
B-actin |
B-actin |
B2M |
|
Beginning (Neutral energy balance) |
B2M |
B2M |
B2M |
B-actin |
|
|
YWHAZ |
GAPDH |
PGK1 |
GAPDH |
|
|
B-actin |
B-actin |
B-actin |
B-actin |
|
Middle (Negative energy balance) |
PPIA |
PPIA |
PPIA |
PPIA |
|
|
POLR2A |
PGK1 |
PGK1 |
POLR2A |
|
|
POLR2A |
G6PDH |
G6PDH |
G6PDH |
|
End (Positive energy balance) |
PPIA |
B2M |
PGK1 |
B2M |
|
|
B2M |
PGK1 |
B-actin |
PGK1 |
To date, there is no study investigating the underlying mechanisms controlling ad- ipose tissue metabolism including gene ex- pression of regulators and enzymes in fat- tailed sheep breeds profoundly. RT-PCR/ quantitative PCR is a sensitive and reliable analysis for investigation of biological pathways involved in tissue metabolism (Fan et al.,2013) which needs some stable reference genes as an internal normal- ization factor to depict changes in target genes expression. Researchers choose the reference genes from other carried out researches even in closed species which does not seem suitable as there is not any reference gene to be stable in all en- vironmental and physiological conditions and also nutritional treatments. Negative energy balance is the consequence of in- creased demands, reduced intake or both which force the body to use its energy reserve to continue the vital metabolic pathways. Enhanced release of free fatty
acids as a consequence of stimulated lip- olysis in response to negative energy bal- ance leads to increased plasma concentra- tion of NEFA. In the current study, plasma NEFA concentration increased more than 4 fold at the end of week 3 compared to the beginning of the experiment which demon- strates that feed restriction was influential to induce negative energy balance.
The rankings of the candidate reference genes by NormFinder and geNorm soft- ware programs were similar in all studied tissues with some negligible differences, whereas ranking by BestKeeper software program was totally different from those of NormFinder and geNorm. For example, G6PDH was defined as the most sta- ble reference gene in fat-tail and muscle tissues by BestKeeper software program, whereas by NormFinder and geNorm soft- ware programs it was considered as the least stable reference gene. The difference in ranking of the reference genes by dif- ferent software programs is in agreement with Najafpanah et al. (2013) and Kaur et
al. (2018) who reported different ranking of candidate reference genes by Norm- Finder and geNorm software programs compared to BestKeeper in different tis- sues. The geNorm program ranks the can- didate reference genes according to mean pairwise variation in a special candidate gene compared to all other candidate ref- erence genes and represents it as M value and subsequently by stepwise elimination of gene with highest M value (Vande- sompele et al., 2007). NormFinder uses an algorithm rooted in mathematical model of gene expression and a solid statistical framework to estimates both variation of inter and intra-group and provide a stabili- ty value for each candidate reference gene (Mallona et al., 2010), whereas BestKeeper determines the optimal reference genes by repeated pairwise correlation analysis (Pfaffl 2001). These differences in mathe- matical algorithms used by various soft- ware programs can explain the observed difference in ranking of the reference genes by different software programs.
Consensus ranking which is the average of candidate reference genes rank calcu- lated by 3 software programs, showed that the 3 most stable genes defined for adipose tissues (GAPDH, PPIA and YWHAZ) are different from those de- fined for longissimus dorsi muscle (B-ac- tin, YWHAZ and PGK1), except for YWHAZ which was among the 3 most stable reference genes in both adipose and muscle tissues. In the studies of Na- jafpanah et al. (2013) and Bonnet et al. (2013), a significant difference in stability of candidate reference genes among var- ious tissues was reported in caprine and bovine respectively. Moreover, in mesen- teric adipose tissue, GAPDH, B-actin and
PPIA was the first 3 most stable reference genes defined by consensus ranking of 3 software programs, whereas in fat-tail adi- pose tissue, PPIA, YWHAZ and POLR2A were the most stable defined reference genes. In the study reported by Zhang et al. (2016), adipose tissues from different depots in rat had different most stable ref- erence gene defined by software programs of NormFinder, geNorm and BestKeeper. The results of current study demonstrate that the stability of reference genes not only varies among different tissues, but also various depots of a special tissue such as adipose tissue can be influen- tial on reference gene stability. Moreover, as it was shown in Fig 3, Ct value of some reference genes including GAPDH, B-actin and PGK1 in longissimus dorsi muscle, PGK1 and G6PDH in fat-tail ad- ipose tissue and B-actin and G6PDH in mesenteric adipose tissue were affected by induction of negative energy balance. These variation in Ct of reference genes can explain the difference in selection of different 3 most stable genes in different periods of energy balance. Gene expres- sion of candidate reference genes was affected by physiological stage of dairy cows (Macabelli et al., 2014; Jatav et al., 2016). The results indicate that the stabil- ity of a reference gene can be affected by physiological status of the animal.
The results of the current study demon- strate that the stability of the reference genes varied between mesenteric and fat- tail adipose tissues and the level of en- ergy balance affects the stability of the reference genes. Therefore, the ideal way for normalization of data related to RT- PCR/quantitative PCR is to define reference genes separately for different tissues and
various depots of tissues such as adipose tissue in every special experimental and environmental condition as the stability of the reference genes varies considerably in various environmental conditions. In addition, ranking of the reference genes differs among different software programs possibly due to different mathematical algorithms used by different programs, hence considering consensus ranking of all software programs would be more log- ical as it can consider all influential fac- tors used by different software programs.
The authors would like to appreciate Mr. Sobhani for his technical assistance during gene expression analysis in bio- technology lab in Animal Science Depart- ment of Tehran University.
The authors declared that there is no con- flict of interest.