Iranian Journal of Veterinary Medicine

Iranian Journal of Veterinary Medicine

Drug Resistance Pattern of Pseudomonas aeruginosa Isolates Carrying MexAB-OprM Efflux Pump’s Associated Genes in Companion Birds with Respiratory Infection

Document Type : Infectious agents- Diseases

Authors
1 Department of Avian Diseases, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran
2 Department of Avian Diseases Faculty of Veterinary Medicine University of Tehran, Tehran, Iran
Abstract
 
BACKGROUND: Pseudomonas aeruginosa is considered one of the most common bacterial pathogens causing nosocomial infections in human cases. However, the pathogenesis of this bacterium in companion birds is poorly understood.

OBJECTIVES: The aim of the present study was to isolate P. aeruginosa from pet birds with respiratory illness manifestations referred to the clinic of the University of Tehran. Moreover, the antimicrobial susceptibility of the recovered P. aeruginosa isolates carrying MexAB-OprM efflux pump was evaluated.

METHODS: Selective media and biochemical tests were used to isolate and identify P. aeruginosa isolates from 126 companion birds. The species-specific polymerase chain reaction (PCR) based on the 16S rRNA gene was applied to confirm P. aeruginosa. In addition, the sensitivity of isolates to 20 antimicrobial agents was assessed by an antimicrobial susceptibility test. Multiplex PCR was used to detect genes associated with MexAB-OprM efflux pump by specific primers in recovered P. aeruginosa isolates.

RESULTS: All seven isolates identified as P. aeruginosa in culture by biochemical tests were confirmed utilizing species-specific PCR. The results of the antimicrobial susceptibility test demonstrated multidrug resistance (MDR) among the isolates with the highest resistance to neomycin, kanamycin, rifampicin, and vancomycin (100% of iso-lates) followed by colistin (57% of isolates). The mexA and oprM genes were detected in all isolates by multiplex PCR, while the mexB gene was not amplified in any of the seven isolates.

CONCLUSIONS: We found P. aeruginosa isolates in sick birds and observed MDR in these isolates. Therefore, companion birds could be considered a potential public health concern, especially for owners and veterinary staff.
Keywords

Introduction

Pseudomonas aeruginosa is a major pathogen in humans and animal species. This bacterium is a ubiquitous microorganism that remains alive under a wide range of environmental conditions. There are many reports of it causing different diseases in both livestock and companion animals (Kidd et al., 2011; Poonsuk & Chuanchuen, 2012). Moreover, many studies noted the occurrence of Pseudomonas infection in various avian species mainly as an opportunistic pathogen (Abdul-Aziz, 2020). Pseudomonas aeruginosa is considered as the cause of some systemic diseases, the death of embryos and hatchlings, airsacculitis, sinusitis, keratitis, kerato-conjunctivitis, yolk sac infection, and septicemia in young birds (Abdul-Aziz, 2020; Razmyar & Zamani, 2016). The diagnosis of Pseudomonas is mostly based on isolation and molecular techniques. The low permeability of the cell membrane along with the efflux pumps has increased resistance to antibiotics in P. aeruginosa. As a result, antibacterial susceptibility tests are recommended before starting the treatment (Loughlin et al., 2002).

The most important mechanism involved in the antimicrobial resistance of P. aeruginosa is the reduced concentration of antimicrobials in the intracellular fluid. The expression of extracellular beta-lactamase from both plasmid and genomic DNA along with enzymes altering the chemical structure of aminoglycosides and ultimately, decreased cell membrane permeability improves the antimicrobial resistance of P. aeruginosa (Aeschlimann, 2003). The MexAB-OprM pump is composed of three parts: 1) a surface protein embedded in the cell membrane called multidrug resistance (MDR) protein MexA, 2) MDR protein MexB responsible for the active transport of antimicrobial agents, and 3) transmembrane protein channels known as outer mem-brane protein OprM involved in sending the substances out of the cell (Mokhonov et al., 2004).

Pseudomonas infection in pet birds leads to upper and lower respiratory tract infections, such as rhinolith, sinusitis, and tracheitis (Harcourt-Brown & Chitty, 2005). There is growing attention to this pathogen because of various clinical signs in companion birds and antimicrobial drug resistance among different strains. The occurrence of P. aeruginosa in pet birds in Iran is poorly investigated. Therefore, further studies are required to provide sufficient information on the prevention and treatment of this pathogen. We isolated P. aeruginosa from companion birds with upper respiratory tract infection in Iran as the first study on the efflux pump family genes in companion birds associated with Pseudomonas infection. In this study, the effectiveness of diverse antimicrobial agents was also evaluated against this microorganism using the agar disk diffusion method.

Materials and Methods

Sampling

A total of 126 companion birds from different orders, including Passeriformes, Psittaciformes, Columbiformes, and Galliformes, which referred with clinical signs to the pet bird clinic of the University of Tehran during February 2018-May 2018 were sampled. Birds with symptoms related to the respiratory system, such as sinusitis, nasal discharge, wheezing, or eye discharge were selected. Swab samples were taken from the eye or choanal slit of each bird and were incubated in enriched tryptose soy broth (TSB) at 37ºC for 24 h (Quinn et al., 2002).

Aliquots of TSB were plated onto both MacConkey agar and blood agar, followed by incubation at 37ºC for 24 h. Colonies were observed by optical microscope after Gram staining to detect Pseudomonas microorganisms. Biochemical tests, including gas production, triple sugar iron (TSI), and motility were performed. The confirmed P. aeruginosa isolates were kept frozen at -70ºC until future use. All media were purchased from HiMedia Laboratories (Pvt. Ltd, India).

Drug Resistance

The resistance of P. aeruginosa isolates to the number of antibacterial medications (Table 1) was determined by the agar disk diffusion method. The results were interpreted based on the Clinical and Laboratory Standards Institute guidelines (CLSI, 2008). The used antibacterial drugs and respective concentrations were amikacin, neomycin, nalidixic acid, tetracycline, gentamycin, ciprofloxacin, vancomycin, norfloxacin, streptomycin, enrofloxacin, levofloxacin, kanamycin, danofloxacin, lincospectin, trimethoprim+ sulfamethoxazole, colistin, ofloxacin, meropenem, rifampicin, and cefotaxime at the concentrations of 30, 30, 30, 30, 10, 5, 30, 10, 10, 5, 5, 30, 10, 15/200, 1.25/23.75, 10, 5, 10, 5, and 30 μg, respectively.

All antibacterial disks were provided by Padtan Teb Co. (Tehran, Iran). The ATCC reference strains Escherichia coli ATCC 25922, P. aeruginosa ATCC 27853, and E. coli ATCC 35218 were utilized for quality control purposes. In this study, the P. aeruginosa isolates with intermediate susceptibility classification were considered not resistant to that medicine, and multi-resistance was defined as resistance to more than one agent.

Molecular Detection

A single polymerase chain reaction (PCR) was employed to confirm the detection of P. aeruginosa. Furthermore, multiplex PCR was used to detect the presence of genes encoding MexAB-Oprm efflux pump involved in antimicrobial resistance. For all PCRs, bacterial DNA was extracted from each isolate using the boiling method as follows: two or three fresh colonies of P. aeruginosa were suspended in 500 µL sterile distilled water and then boiled for 10 min at 100ºC. Afterward, the mixture was centrifuged for 5 min and the supernatant containing chro-mosomal DNA was collected for PCR.

Bacterial isolates identified as P. aeruginosa by both bacteriological and biochemical tests were subjected to species-specific (SS) PCR using 16S rRNA set of primers as forward (5’- GGGGGATCTTCGGACCTCA-3’) and reverse (5’-TCCTTAGAGT-GCCCACCCG-3’) (Spilker et al., 2004). Amplification reactions were carried out in a 50 μL reaction volume containing 25 µL of 2x master mix (Ampliqon, Denmark), 1 μL (100 pmol) of each of forward and reverse primers (with 10 pmol concentration), and 19 µL deionized H2O. Approximately 100 ng of template DNA (4 μL) was added to the mixture. Negative controls (dH2O instead of template DNA) were included in all PCR reaction sets. The amplification program in the thermocycler (SensoQuest, Germany) was 95°C for 2 min followed by 25 cycles of 94°C for 20 s, 59°C for 20 s, 72°C for 40 s, and a final extension at 72°C for 1 min. Agarose gel electrophoresis was used to show the amplified DNA bands in 1% agarose gel at 70 V for 80 min in 1x TAE buffer.

Genes encoding MexAB-OprM efflux pump were detected by specific primers targeting mexA, mexB, and oprM antimicrobial resistance (AR) genes using multiplex PCR. The sequences of primers applied to amplify mexA, mexB, and oprM genes are shown in Table 2 (Arabestani et al., 2015). Amplification reactions were carried out in a 50 μL reaction volume containing 25 µL of 2x master mix (Ampliqon), 2 µL of each primer set, and 19 µL dH2O. Approximately 100 ng of template DNA (4 μL) was added to the mixture. In all PCR reaction sets, the standard strain of P. aeruginosa as positive control and dH2O instead of template DNA as negative controls were included. The amplification program in the thermocycler (SensoQuest, Germany) was as follow 94°C for 5 min followed by 30 cycles of 94°C for 30 s, 67°C for 30 s, 72°C for 1 min, and a final extension at 72°C for 5 min. Agarose gel electrophoresis was used to show the amplified DNA bands in 1% agarose gel at 70 V for 90 min in 1x TAE buffer.

Results

Bacteriological Findings

A total of seven P. aeruginosa isolates were identified from swab samples using both bacteriological and biochemical tests. These isolates were from different bird species, including five domestic canaries, one pigeon, and one cockatiel.

Drug Resistance

The antimicrobial susceptibility test indicated that P. aeruginosa isolates from companion birds were 100% resistant to neomycin, kanamycin, rifampicin, and vancomycin (Table 1). No resistance was observed to 13 out of 20 antimicrobial agents. Four resistance patterns were found for seven isolates, three isolates of which (42.8%) had pattern 1 and two isolates (28.6%) had pattern 2 (Table 3). Each of the two remaining isolates belonged to a single pattern. All isolates were the MDR type with variable resistance to 4-6 antimicrobial agents (Table 4).

 

 

Table 1. Antimicrobial susceptibility of seven Pseudomonas aeruginosa isolates

No.

Antimicrobial agent

Resistant

Susceptible

No. (%)

No. (%)

1

Streptomycin

3 (42.8)

4 (57.2)

2

Levofloxacin

7 (100)

0 (0)

3

Danofloxacin

7 (100)

0 (0)

4

Norfloxacin

7 (100)

0 (0)

5

Cefotaxime

1 (14.3)

6 (85.7)

6

Kanamycin

0 (0)

7 (100)

7

Linco-spectin

7 (100)

0 (0)

8

Gentamycin

7 (100)

0 (0)

9

Ciprofloxacin

7 (100)

0 (0)

10

Vancomycin

0 (0)

7 (100)

11

Amikacin

7 (100)

0 (0)

12

Tetracycline

7 (100)

0 (0)

13

Neomycin

0 (0)

7 (100)

14

Nalidixic acid

0 (0)

7 (100)

15

Trimethoprim-Sulfamethoxazole

7 (100)

0 (0)

16

Ofloxacin

7 (100)

0 (0)

17

Meropenem

7 (100)

0 (0)

18

Colistin

3 (42.8)

4 (57.2)

19

Enrofloxacin

7 (100)

0 (0)

20

Rifampicin

0 (0)

7 (100)

 

Table 2. The sequences of primers used in this study

Product size (bp)

Sequence (5’–3’)

Gene

503

CTCGACCCGATCTACGTC

GTCTTCACCTCGACACCC

MexA-F

MexA-R

280

TGTCGAAGTTTTTCATTGAG

AAGGTCACGGTGATGGT

MexB-F

MexB-R

247

GATCCCCGACTACCAGCGCCCCG

ATGCGGTACTGCGCCCGGAAGGC

OPrM-F

OPrM-R

 

Table 3. Drug resistance patterns among seven Pseudomonas aeruginosa isolates

Pattern #

Resistant to

No. of isolates (%)

1

Kanamycin, Vancomycin, Neomycin, Rifampicin

3 (42.8)

2

Kanamycin, Vancomycin, Neomycin, Rifampicin, Colistin

2 (28.6)

3

Kanamycin, Vancomycin, Neomycin, Rifampicin, Colistin, Nalidixic acid

1 (14.3)

4

Kanamycin, Vancomycin, Neomycin, Rifampicin, Colistin, Streptomycin

1 (14.3)

 

Table 4. Multidrug resistance among seven Pseudomonas aeruginosa isolates

No. of resistant isolates (%)

No. of antimicrobial agents

7 (100%)

4 ≤

4 (57%)

5 ˂

2 (28%)

6 ˂

 

 

Molecular Detection

By PCR and specific primers for 16S rRNA, a 965 bp fragment was amplified in all the seven isolates and positive control followed by detection using agar gel electrophoresis. This observation confirmed the presence of P. aeruginosa (Figure 1). Multiplex PCR was employed in order to detect the resistance genes encoding the mexAB-OprM efflux pump. For each isolate, the reaction was repeated at least four times. The results showed 503 bp and 247 bp PCR products in all these isolates indicating the presence of mexA and oprM, respectively. Neither in clinical nor in positive control isolates, any fragment representing the mexB gene was detected (Figure 2).

 

Figure 1. Electrophoresis of PCR-amplified 16 rRNA gene of Pseudomonas aeruginosa field isolates on %1 agarose gel. Amplified 965 bp bands of field isolates are shown in lanes 1 to 7. Lanes M, C+, and C- indicate 1 kb ladder, positive control, and negative control (dH2O instead of cDNA), respectively.

 

Figure 2. Electrophoresis of PCR-amplified mexAB and OprM genes of Pseudomonas aeruginosa field isolates on %1 agarose gel. Amplified 503 bs (for MexA gene) and 247 (for OPrM gene) bp bands of field isolates are shown in lanes 1 to 7. Lanes M, C+, and C- indicate 1 kb ladder, positive control, and negative control (dH2O instead of cDNA), respectively.

 

Discussion

Pseudomonas aeruginosa can be found everywhere allowing the organism to spread through vari-ous routes. The pathogenicity of P. aeruginosa is mostly associated with opportunistic infection. This finding emphasizes the role of other microorganisms in enhancing susceptibility to P. aeruginosa. Infection due to P. aeruginosa in companion birds is a great danger not only for the life of the birds but also for the health of its owner. Reports on Pseudomonas infection in companion birds have been reviewed recently (Abdul-Aziz, 2020).

Pseudomonas aeruginosa can be freely transferred from birds to humans and vice versa. The severity of infection and disease outcome depend on the health status of the bird, pathogen virulence, and delay in treatment. The MDR capability of P. aeruginosa made the treatment of this ubiquitous organism even harder. The presence of the MexAB-OprM efflux pump complex encoded by related genes plays a key role in the determination of the level of antimicrobial resistance of P. aeruginosa (Terzi et al., 2014).

The findings of the present study revealed the presence of both MexA and OprM in all isolates, while MexB was not detected in any of these isolates. The high expression of mexR and OprD was reported in different P. aeruginosa isolates recovered from hospital patients using qPCR (Arabestani et al., 2015). Some studies discovered the lack of efflux genes among some P. aeruginosa clinical isolates and the majority of the rest (60%) demonstrated the combination of mex-B and oprD genes (Zaki et al., 2017). The overexpression of the MexAB-Oprm efflux pump has been reported to elevate the resistance of P. aeruginosa isolates to antimicrobial agents, such as carbapenem, amikacin, gentamicin, ciprofloxacin, and meropenem with a range of 32%-84.5% (Pan et al., 2016; Pourakbari et al., 2016).

Although the important role of the MexAB-Oprm efflux pump in the resistance of P. aeruginosa to antimicrobial agents has been shown, the function of other mechanisms in the development of resistance should not be ignored. To illustrate, the mutations in distinct regions of MexR and NaID have been found to upregulate the mexA gene, and also the high expre-ssion of OprD can result in resistance to carbapenems (Arabestani et al., 2015; Pan et al., 2016).

In the present study, all seven isolates were resistant to neomycin, kanamycin, rifampicin, and vancomycin. However, no resistance to meropenem and fluoroquinolones, namely ciprofloxacin, danofloxacin, norfloxacin, ofloxacin, and enrofloxacin was observed. The high susceptibility to fluoroquinolones was also reported previously in P. aeruginosa isolates from companion birds (Yakimova et al., 2016). Contradictory findings on antimicrobial susceptibility were represented in studies conducted on P. aeruginosa isolated from nosocomial infections in which high resistance was reported against meropenem, ciprofloxacin, amikacin, and gentamicin (Doosti et al., 2013; Arabestani et al., 2015; Hashemi et al., 2016: Pourakbari et al., 2016; Zaki et al., 2017; Ghasemian et al., 2018).

The difference in antimicrobial susceptibility might be due to the absence of the mexB gene in isolates of our study. In addition, high susceptibility to fluoroquinolones was reported in benzalkonium chloride-adapted P. aeruginosa cells (Loughlin et al., 2002). These results imply that P. aeruginosa isolated from nosocomial infections are more resistant to antimicrobial agents. It might be due to the broad usage of disinfectants causing alteration in cell surface structure and the overexpression of MexAB-OprM efflux pumps.

Conclusion

In conclusion, P. aeruginosa can be considered as one of the causative pathogens of upper respiratory problems in companion birds. Seven isolates of P. aeruginosa in this study showed distinct antimicrobial susceptibility patterns, compared to those of P. aeruginosa isolated from nosocomial infections in human cases. It indicates variable drug resistance profiles among P. aeruginosa isolates originated from different sources of infection. Therefore, an antibacterial susceptibility test prior to the adminis-tration of any antimicrobial agent to patients is important for avoiding an increase in resistance. Conc-urrent infections with other pathogens of the respiratory tract and transmission from humans or other animals along with environmental factors should be considered in P. aeruginosa infections.

Acknowledgments

This research was supported by grant no. 7508007-6-38 from the Research Council of the University of Tehran.

Conflict of Interest

The authors declared no conflict of interest.

 

 

Abdul-Aziz, T. (2020). Miscellaneous and sporadic bacterial infections. Diseases of Poultry. 14th ed. Ames, IA: Wiley-Blackwell, 1017-1027.
Aeschlimann, J. R. (2003). The role of multidrug efflux pumps in the antibiotic resistance of Pseudomonas aeruginosa and other gram‐negative bacteria: insights from the Society of Infectious Diseases Pharmacists. Pharmacotherapy: The Journal of Human Pharmacology and Drug Therapy, 23(7), 916-924. [DOI:10.1592/phco.23.7.916.32722]
Arabestani, M. R., Rajabpour, M., Yousefi Mashouf, R., Yousef Alikhani, M., & Mousavi, S. M. (2015). Expression of Efflux Pump MexAB-OprM and OprD of Pseudomonas aeruginosa Strains Isolated from Clinical Samples using qRT-PCR. Archives of Iranian Medicine, 18(2), 0-0.
Doosti, M., Ramazani, A., & Garshasbi, M. (2013). Identification and Characterization of Metallo-β-Lactamases Producing Pseudomonas aeruginosa Clinical Isolates in University Hospital from Zanjan Province, Iran. Iranian Biomedical Journal, 17(3), 129-133.
Ghasemian, A., Salimian Rizi, K., Rajabi Vardanjani, H., & Nojoomi, F. (2018). Prevalence of Clinically Isolated Metallo-beta-lactamase-producing Pseudomonas aeruginosa, Coding Genes, and Possible Risk Factors in Iran. Iranian Journal of Pathology, 13(1), 1-9. [DOI:10.30699/ijp.13.1.1]
Harcourt-Brown, N., & Chitty, J. (2005). BSAVA manual of psittacine birds: British Small Animal Veterinary Association.
Hashemi, A., Fallah, F., Erfanimanesh, S., Chirani, A. S., & Dadashi, M. (2016). Detection of antibiotic resistance genes among Pseudomonas aeruginosa strains isolated from burn patients in Iran. Microbiology Research Journal International, 1-6.  [DOI:10.9734/BMRJ/2016/23268]
Kidd, T. J., Gibson, J. S., Moss, S., Greer, R. M., Cobbold, R. N., Wright, J. D., . . . Bell, S. C. (2011). Clonal complex Pseudomonas aeruginosa in horses. Veterinary Microbiology, 149(3-4), 508-512. [DOI:10.1016/j.vetmic.2010.11.030]
Loughlin, M. F., Jones, M. V., & Lambert, P. A. (2002). Pseudomonas aeruginosa cells adapted to benzalkonium chloride show resistance to other membrane-active agents but not to clinically relevant antibiotics. Journal of Antimicrobial Chemotherapy, 49(4), 631-639. [DOI:10.1093/jac/49.4.631]
Mokhonov, V. V., Mokhonova, E. I., Akama, H., & Nakae, T. (2004). Role of the membrane fusion protein in the assembly of resistance-nodulation-cell division multidrug efflux pump in Pseudomonas aeruginosa. Biochemical and Biophysical Research Communications, 322(2), 483-489. [DOI:10.1016/j.bbrc.2004.07.140]
Pan, Y.-p., Xu, Y.-h., Wang, Z.-x., Fang, Y.-p., & Shen, J.-l. (2016). Overexpression of MexAB-OprM efflux pump in carbapenem-resistant Pseudomonas aeruginosa. Archives of Microbiology, 198(6), 565-571. [DOI:10.1007/s00203-016-1215-7]
Poonsuk, K., & Chuanchuen, R. (2012). Contribution of the MexXY Multidrug Efflux Pump and Other Chromosomal Mechanisms on Aminoglycoside Resistance in Pseudomonas aeruginosa Isolates from Canine and Feline Infections. Journal of Veterinary Medical Science, 74(12), 1575-1582. [DOI:10.1292/jvms.12-0239]
Pourakbari, B., Yaslianifard, S., Yaslianifard, S., Mahmoudi, S., Keshavarz-Valian, S., & Mamishi, S. (2016). Evaluation of effluxpumps gene expression in resistant Pseudomonas aeruginosa isolates in an Iranian referral hospital. Iranian Journal of Microbiology, 8(4). 
Quinn, P., Markey, B. K., Carter, M., Donnelly, W., & Leonard, F. (2002). Veterinary microbiology and microbial disease: Blackwell science.
Razmyar, J., & Zamani, A. H. (2016). An outbreak of yolk sac infection and dead-in-shell mortality in common canary (Serinus canaria) caused by Klebsiella pneumoniae. Iranian Journal of Veterinary Research, 17(2), 141-143.
Spilker, T., Coenye, T., Vandamme, P., & LiPuma, J. J. (2004). PCR-Based Assay for Differentiation of Pseudomonas aeruginosafrom Other Pseudomonas Species Recovered from Cystic Fibrosis Patients. Journal of Clinical Microbiology, 42(5), 2074-2079.  [DOI:10.1128/JCM.42.5.2074-2079.2004]
Terzi, H. A., Kulah, C., & Ciftci, İ. H. (2014). The effects of active efflux pumps on antibiotic resistance in Pseudomonas aeruginosa. World Journal of Microbiology and Biotechnology, 30(10), 2681-2687.  [DOI:10.1007/s11274-014-1692-2]
Yakimova, E. A., Laishevtcev, A. I., Kapustin, A. V., Lenev, S. V., Motorygin, A. V., & Kuteynikova, N. S. (2016). Antibiotic resistance of field isolates of Pseudomonas aeruginosa isolated from exotic and ornamental birds. Russian Journal of Agricultural and Socio-Economic Sciences, 55(7), 3-7. DOI:10.18551/rjoas.2016-07.01]
Zaki, M., Elewa, A., & Al-Kasaby, N. M. (2017).
         Molecular Study of Efflux Genes in Pseudomonas aeruginosa Isolated from Clinical Samples. International Journal of Current Microbiology and Applied Sciences, 6(7), 4549-4556. [DOI:10.20546/ijcmas.2017.607.475]